LOCUS       XR_878709                645 bp    RNA     linear   ROD 07-FEB-2024
DEFINITION  PREDICTED: Mus musculus predicted gene, 42009 (Gm42009), transcript
            variant X2, ncRNA.
ACCESSION   XR_878709
VERSION     XR_878709.4
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000071.7) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 21, 2020 this sequence version replaced XR_878709.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001635.27-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/01/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..645
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="5"
     gene            1..645
                     /gene="Gm42009"
                     /note="predicted gene, 42009; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 14 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105246770"
                     /db_xref="MGI:MGI:5624894"
     ncRNA           1..645
                     /ncRNA_class="lncRNA"
                     /gene="Gm42009"
                     /product="predicted gene, 42009, transcript variant X2"
                     /db_xref="GeneID:105246770"
                     /db_xref="MGI:MGI:5624894"
ORIGIN      

ctcaggcactctctcctcctcctcctgctccgctccgcccccgccctccctctgcctccagcagcgtccactccatccacccgtgccccgcagggcactaaagccagactattaataaccctccgcctggctgagggctcaggtcacactctggaaataccatcttcagtgcatgttctgtcttgcctcctactctagggactcgcagaagagagacagcccctcattggatcaagaagtacaaggaatccccacttacagtatggcccaagtcttacagcctcagacttctgagaacgaaattttaaaaaacggcagtttaagttatgaaaagagggacgttgtcagtcagagtctattgggataggcctctttgcacatcttcattgagaatttctagaggcccttctgcctggaaccaagaagggagaaagcttgacagcactgaattgagcatcttttgtggcctgtgcttctccccacccagcaccccctcccccttgcccttgtctctcatgtagcacaggcaaaccttgagctccttatacaacagacggtgaccttgaactcccacttgcccttgtctctcatgtagcacaggcaaaccttgagctccttatacaacagacggtgaccttgaactcc

//