ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-27 23:12:37, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_013601306 305 bp RNA linear VRT 21-JAN-2026
DEFINITION PREDICTED: Lissotriton helveticus uncharacterized LOC144782902
(LOC144782902), ncRNA.
ACCESSION XR_013601306
VERSION XR_013601306.1
DBLINK BioProject: PRJNA1395635
KEYWORDS RefSeq.
SOURCE Lissotriton helveticus (palmate newt)
ORGANISM Lissotriton helveticus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Amphibia; Batrachia; Caudata; Salamandroidea; Salamandridae;
Pleurodelinae; Lissotriton.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_136070) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_964261635.1-RS_2025_12
Annotation Pipeline :: NCBI Eukaryotic Genome Annotation
Pipeline (EGAP)
Annotation Software Version :: 10.5
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 12/30/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..305
/organism="Lissotriton helveticus"
/mol_type="transcribed RNA"
/db_xref="taxon:256425"
/chromosome="9"
gene 1..305
/gene="LOC144782902"
/note="uncharacterized LOC144782902; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 100%
coverage of the annotated genomic feature by RNAseq
alignments, including 1 sample with support for all
annotated introns"
/db_xref="GeneID:144782902"
ncRNA 1..305
/ncRNA_class="lncRNA"
/gene="LOC144782902"
/product="uncharacterized LOC144782902"
/db_xref="GeneID:144782902"
ORIGIN
ggggataccaatgtcaatatcttctaggattgtaaatctatttatggtgccatctattcaagaagagattgtgttctgggccatccatcaaatgacaattcaatacggaccagaaattgaatcacacctgggtctggttctcagaaccttctatcctatattgaagactgcttctacagtcaaccagaaatattggtttagccttgtcattgagatgttagcaggccagtttgctgcctctgtagatgctcccctagtcacacttttctttgaagcctactcagcttgcaaggtctttcttcttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]