ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 22:20:12, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_013517489 860 bp RNA linear PLN 24-DEC-2025 DEFINITION PREDICTED: Carex rostrata testis- and ovary-specific PAZ domain protein (LOC144571339), transcript variant X2, misc_RNA. ACCESSION XR_013517489 VERSION XR_013517489.1 DBLINK BioProject: PRJNA1391555 KEYWORDS RefSeq. SOURCE Carex rostrata ORGANISM Carex rostrata Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Cyperaceae; Cyperoideae; Cariceae; Carex; Carex subgen. Carex. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_135936) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_964058835.1-RS_2025_12 Annotation Pipeline :: NCBI Eukaryotic Genome Annotation Pipeline (EGAP) Annotation Software Version :: 10.5 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 12/22/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..860 /organism="Carex rostrata" /mol_type="transcribed RNA" /db_xref="taxon:241230" /chromosome="19" /geo_loc_name="United Kingdom:Aberlady" /collection_date="2021-06-14" gene 1..860 /gene="LOC144571339" /note="testis- and ovary-specific PAZ domain protein; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 22 samples with support for all annotated introns" /db_xref="GeneID:144571339" misc_RNA 1..860 /gene="LOC144571339" /product="testis- and ovary-specific PAZ domain protein, transcript variant X2" /db_xref="GeneID:144571339" ORIGIN
ataatcagacgtaaagatgaagaaacgaccgttacttgtgcgttacacctatgccaaattgcccatattgaatacttcctccaatcggaagaatcgaagctggttcttctccatacttgaggcaactcagatcctctctctctctctctcttttgtttctctttttctctaatgcataataatcccattctacaattttatgtaatacagtatttctctgccattatttttgtttgtcaattaagtattgggtgcggaacaattgaacatgcggcttcgacacaaagaaggattgaatgaatctttggaggcagagcaccattctttggcgagtttagtagtgataaggagagcacatacaacaaaagaagccatagaggatttgctctgggttgtttttgccatttttatcgtatatttgggtgattgccaaactaatctggtgtctatcttgctctgggacccgaggattgatcgctttgctgcttgggctatcgggcgtttcacttaatgtcggctttatcctttattcgacatttttgtccagctatagactgaaatttcataaagaacatgagctatctaatgtagaagcacctacattattagacgagaagcctgaattctctctaaagattacaaggtttcttctcctcatagggatttctacattttgcatgttattgtatgcattatggccaatttggagatttttgagcattcttcttttgctttccttgctaatgtcttccacagctatgtcaccatacttggtaggagcggtaaccaaatttctgattcttgctttctgaagagaaatgcatgtattaccataattagatcaccaaacctctcttgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]