LOCUS       XR_013287577             649 bp    RNA     linear   VRT 18-NOV-2025
DEFINITION  PREDICTED: Festucalex cinctus uncharacterized LOC144031661
            (LOC144031661), ncRNA.
ACCESSION   XR_013287577
VERSION     XR_013287577.1
DBLINK      BioProject: PRJNA1336712
KEYWORDS    RefSeq.
SOURCE      Festucalex cinctus (girdled pipefish)
  ORGANISM  Festucalex cinctus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei;
            Syngnathidae; Festucalex.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135422) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_051991245.1-RS_2025_11
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/17/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..649
                     /organism="Festucalex cinctus"
                     /mol_type="transcribed RNA"
                     /isolate="MCC-2025b"
                     /isolation_source="wild-caught"
                     /db_xref="taxon:1073243"
                     /chromosome="12"
                     /sex="male"
                     /tissue_type="muscle/skin/bone"
                     /dev_stage="adult"
                     /geo_loc_name="Australia: NSW"
                     /collection_date="2024-01-01"
     gene            1..649
                     /gene="LOC144031661"
                     /note="uncharacterized LOC144031661; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:144031661"
     ncRNA           1..649
                     /ncRNA_class="lncRNA"
                     /gene="LOC144031661"
                     /product="uncharacterized LOC144031661"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:144031661"
ORIGIN      

gatgtctccctgagcagtcctgttccagtcgaggcgttggaagggataagcgaggatggtccatccacaagcggaagctgcgcccctctgtcaacttccacttcaaatgatgaagtgagtgaacattcgcggctacgagcagaatcagcagagctgttcctgagccttctgccttgctctcccgtccagctggaccttctctgtgctctcctttacgttatgatgcctccctgaacagtcctggttagcggacacgggaccgagaccacctatttttggaatacctgcaccaatttgatgaaaagaagggggagtccacgagtgcaatgttcttagaagaaatgcagttgcacaaggaggaccttgaactcagacgcgagcagcacaaggaggaccttgaactcagacgcgagcagcacaaggaggaagttgacctcagaagcgaggagcgcaaggaagatcaacacgtggcacatgagctggttgaacaaaggcacgacagagagttccaaatgggcttcctggcagtccaaaacagacttgtggacacaaataagccaaatgcataagtaataaatgcttttgttttcatatcacttttgtggttctgggtttttttccacacgaataaaaacttatgctcaatgaa

//