2025-08-29 22:30:35, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_012488168 405 bp RNA linear MAM 03-JUN-2025 DEFINITION PREDICTED: Sminthopsis crassicaudata uncharacterized LOC141561823 (LOC141561823), ncRNA. ACCESSION XR_012488168 VERSION XR_012488168.1 DBLINK BioProject: PRJNA1266204 KEYWORDS RefSeq. SOURCE Sminthopsis crassicaudata (fat-tailed dunnart) ORGANISM Sminthopsis crassicaudata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Metatheria; Dasyuromorphia; Dasyuridae; Sminthopsis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_133619) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_048593235.1-RS_2025_05 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 05/29/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..405 /organism="Sminthopsis crassicaudata" /mol_type="transcribed RNA" /isolate="SCR6" /db_xref="taxon:9301" /chromosome="3" /sex="female" /tissue_type="fibroblast" /geo_loc_name="Australia: Melbourne" gene 1..405 /gene="LOC141561823" /note="uncharacterized LOC141561823; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:141561823" ncRNA 1..405 /ncRNA_class="lncRNA" /gene="LOC141561823" /product="uncharacterized LOC141561823" /db_xref="GeneID:141561823" ORIGIN
taaagttctgtttgtatagagtgtctattagaagctttgcatctgtggttagcagaccgtaacctagaactgtcactttgctggtcgatattctcctaggaaacaaaatacagaagaaattttaaatagtgacttcaaatatgatgaggacaagtctagatgaagaactcagagaaatagcccacattcaaagtggcacagaatggacctcattcaatatttccaaggtatcctggagttgttggacagcaaacaatgtatcaaacatttctcaggcctttctgaagccatcctggatctcaggaagacgaccacttttcagatggacaatggtagcattcttatgaattctcaaaagacaatctcttcttgccatataacctggaatactttagtcaccttttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]