2025-08-29 22:30:36, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_012040677 451 bp RNA linear VRT 03-APR-2025 DEFINITION PREDICTED: Ciconia boyciana uncharacterized lncRNA (LOC140647122), ncRNA. ACCESSION XR_012040677 VERSION XR_012040677.1 DBLINK BioProject: PRJNA1244888 KEYWORDS RefSeq. SOURCE Ciconia boyciana (Oriental stork) ORGANISM Ciconia boyciana Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Aequornithes; Ciconiiformes; Ciconiidae; Ciconia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_132935) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_034638445.1-RS_2025_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/02/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..451 /organism="Ciconia boyciana" /mol_type="transcribed RNA" /db_xref="taxon:52775" /chromosome="2" gene 1..451 /gene="LOC140647122" /note="uncharacterized LOC140647122; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:140647122" ncRNA 1..451 /ncRNA_class="lncRNA" /gene="LOC140647122" /product="uncharacterized lncRNA" /db_xref="GeneID:140647122" ORIGIN
gaccacaggacagtcaggaagaaaaagtgaaatattttattcactcatggggccaaacttgcttaatgcctgccaagccttcaccaagaaaggaattgccaacagcctctagagttagaatggaatatgacagcactttatgcatgtaaaagacccagagttcatgctttactgagcagaaaccagcaatctcttcttgcctctacctctccttctacttttgatgtgttttttccgtgctgtggaaactcgtgcagaattgttatgccagttggacagaattttatagccaaaagttcaaccctgctgtttggctctatggactccacaccgtcgtcattcacgcaggcactgccaatgactcatcaaagatgatgtcccagatgtccctcttcttcccctgccaagcttgccaaatacctctttggcatgccacccaaaggacagaagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]