2025-04-03 19:42:53, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_010707750 325 bp RNA linear INV 28-JUN-2024 DEFINITION PREDICTED: Magallana gigas uncharacterized lncRNA (LOC136270079), ncRNA. ACCESSION XR_010707750 VERSION XR_010707750.1 DBLINK BioProject: PRJNA1118722 KEYWORDS RefSeq. SOURCE Magallana gigas (Pacific oyster) ORGANISM Magallana gigas Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia; Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae; Magallana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_088859) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963853765.1-RS_2024_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/20/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..325 /organism="Magallana gigas" /mol_type="transcribed RNA" /db_xref="taxon:29159" /chromosome="7" gene 1..325 /gene="LOC136270079" /note="uncharacterized LOC136270079; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:136270079" ncRNA 1..325 /ncRNA_class="lncRNA" /gene="LOC136270079" /product="uncharacterized lncRNA" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:136270079" ORIGIN
cacagatccagcccgcctttcacagaacattcttgtacaaacacttcatacaacacatggagctccaaaagaggaattgttacaaaatacttatagatatctccgatcagattgattactaaattcaattatgtactacagtgtatcgtgtagctatcaatttgaccttgaatttaatgaatgaccttgaacttcgccttttgttttaaccatgaccttgaacttcgccttttgttttaacttggttacctcttagattacaaaatatgaattcattttcttattagtgtaaaagtaatggaagatagaaaaacaacaacaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]