GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-03 19:41:12, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XR_010176114             691 bp    RNA     linear   VRT 25-MAR-2024
DEFINITION  PREDICTED: Pseudophryne corroboree uncharacterized LOC134910094
            (LOC134910094), ncRNA.
ACCESSION   XR_010176114
VERSION     XR_010176114.1
DBLINK      BioProject: PRJNA1082331
KEYWORDS    RefSeq.
SOURCE      Pseudophryne corroboree (corroboree frog)
  ORGANISM  Pseudophryne corroboree
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Neobatrachia; Myobatrachoidea;
            Myobatrachidae; Myobatrachinae; Pseudophryne.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_086447) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_028390025.1-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/29/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..691
                     /organism="Pseudophryne corroboree"
                     /mol_type="transcribed RNA"
                     /isolate="aPseCor3"
                     /db_xref="taxon:495146"
                     /chromosome="4"
                     /sex="male"
                     /tissue_type="kidney, liver"
                     /dev_stage="adult"
                     /geo_loc_name="Australia: Melbourne"
                     /lat_lon="37.801993 S 144.959087 E"
                     /collection_date="2020-11-03"
                     /collected_by="Lee Berger"
     gene            1..691
                     /gene="LOC134910094"
                     /note="uncharacterized LOC134910094; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:134910094"
     ncRNA           1..691
                     /ncRNA_class="lncRNA"
                     /gene="LOC134910094"
                     /product="uncharacterized LOC134910094"
                     /db_xref="GeneID:134910094"
ORIGIN      
tttttacttatcaacagatggttcccatggaaatttgcctgtgacacggcccagcgcatgccaggggttggcaatacgtgaccgcagccggtccaactggcgggcagcagagctggggagcgggcgatctctatggttaccatggcgaccagcctgcgacatggtgcacggtgacgtcactagtgggcgttgcggaagcggtgccggacccatggacagacgtgttgcgccattgagcagggacagggcccactcttgctgttgggtgggaaacaatgtgaagaaaacctgcaggtttaccatgttggaacatcctacctggacaccgaaaagatgtggacacttcacccttacaacacacacttggaaggcctactggtgatgtggaaacccccttgtgtcgtgtatacctttcaggttttccttggatgtatttgcagacccagaccttgaacccctctactgtggaaagtggtgcttacaccccccctgtacctggacggcctacttgtgatgaggaccccccactctggtgtaaccaggagacccttcaggtttcccttggatgtacttgcagaccttgaacagccttggatactctgaattaccccacaccccttgaatgtctacttctaattgatgtggaatagtaatttactattactttaacaattattgaaagacaacacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]