LOCUS       XR_005750643            1457 bp    RNA     linear   VRT 25-MAR-2021
DEFINITION  PREDICTED: Rana temporaria uncharacterized LOC120946061
            (LOC120946061), ncRNA.
ACCESSION   XR_005750643
VERSION     XR_005750643.1
DBLINK      BioProject: PRJNA714106
KEYWORDS    RefSeq.
SOURCE      Rana temporaria (common frog)
  ORGANISM  Rana temporaria
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Ranidae; Rana;
            Rana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_053495.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rana temporaria Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1457
                     /organism="Rana temporaria"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:8407"
                     /chromosome="7"
     gene            1..1457
                     /gene="LOC120946061"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 108
                     samples with support for all annotated introns"
                     /db_xref="GeneID:120946061"
     ncRNA           1..1457
                     /ncRNA_class="lncRNA"
                     /gene="LOC120946061"
                     /product="uncharacterized LOC120946061"
                     /db_xref="GeneID:120946061"
ORIGIN      

tacgtttctgaatcggcgtatctaggtcatttgcatattcgacgcagaaaatctacggtagcggccagcgtaaaatggcacacaattttacgccggcgtttgcaatttacgtcggcggaggaagcctattttttcaacgtatctgcctttgagaatcggtgtaaaaatatgacggcgcagatttggaattacggcggcgtatctggagatacgccgccgtaagttgtttctgaatctggccctctatttttatgtagatcattctcataaggcctcattctctggagtgttggcagagcccagaaaatgatgggttctattttaaagtagccacattttttcccagttttatagcttcatacagtggtaagggtgagaagcgttggaccgcctggcatgttatgtttcatggtaagtatcatgtggaggtttggtaggaagctgtactaggcctagggtggtccttatgggaatatgggggaagggtggaggatagaagcaccactcctatggtggaagtccagaataacattttatttctaatcggcaagaaaattccaaaatagtttcgggggatggaagggttgcccttcttcagggcaagagaaaaaggcgtttgagatctgagctgctgaacttaagctggaataggggggtgtgaataaggctcagtgggggggtattttcaatatgaatgacctgagactagaacacagggacatgacctgagactagaacacagggacatggcctgagactagaacacagggacatggcctgagactaaaacacaggggcatgacccgagactagaacacaggggcatgacccgagactagaacacagggacatgacccgagactagaacacagggaaatgacccgagactagaacacagggacatgatccgagactagaacacagggacatggcccgagactagaacacagggacatggcccgagactagaacacagggacatggcccgagactagaacacagggacatggcccgagactagaacacagggacatggcccgagactagaacacaggggcatggcctgagactagaacacaggggcatggcctgagactagaacacaggggcatggcctgagactagaacacaggggcatggcctgagactagaacacaggggcatggcctgagactagaacacaggggcatggcccgagactagaacacaggggcatggcctgagactagaacaaaggggcatggcctgagactagaacacggggacatgaccttgaactagaacacggggacatgaccttgaactagaacacggggacatgaccttgaactaaaacacggggacatgaccttgaactagaacacggggacatgaccttgaactagaacacggggacatgaccttgaactagcacacggggacatgacttgagactagaaaacgaggacatgacctga

//