2024-04-26 17:00:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_003850833 103 bp RNA linear ROD 24-JUN-2019 DEFINITION PREDICTED: Nannospalax galili U6 spliceosomal RNA (LOC115071755), ncRNA. ACCESSION XR_003850833 VERSION XR_003850833.1 DBLINK BioProject: PRJNA254049 KEYWORDS RefSeq. SOURCE Nannospalax galili (Upper Galilee mountains blind mole rat) ORGANISM Nannospalax galili Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Spalacidae; Spalacinae; Nannospalax. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_008345224.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Nannospalax galili Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..103 /organism="Nannospalax galili" /mol_type="transcribed RNA" /isolate="Female #2095" /db_xref="taxon:1026970" /chromosome="Unknown" /sex="female" /tissue_type="brain" /country="Israel: Animal Facility of the Institute of Evolution, University of Haifa" gene 1..103 /gene="LOC115071755" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:115071755" ncRNA 1..103 /ncRNA_class="snRNA" /gene="LOC115071755" /product="U6 spliceosomal RNA" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00026" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:115071755" /db_xref="RFAM:RF00026" ORIGIN
gtgcttgcgtcggcatcacttacattaaaattggaatgatacagagattaccatggccctaggtcagaatgacctacaaattggtgaagcgttacattttttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]