2024-05-02 10:42:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001966572 1690 bp RNA linear VRT 22-MAY-2019 DEFINITION PREDICTED: Scleropages formosus testis and ovary specific PAZ domain containing 1 (topaz1), transcript variant X7, misc_RNA. ACCESSION XR_001966572 VERSION XR_001966572.2 DBLINK BioProject: PRJNA540586 KEYWORDS RefSeq. SOURCE Scleropages formosus (Asian bonytongue) ORGANISM Scleropages formosus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Osteoglossocephala; Osteoglossomorpha; Osteoglossiformes; Osteoglossidae; Scleropages. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_041823.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On May 22, 2019 this sequence version replaced XR_001966572.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Scleropages formosus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1690 /organism="Scleropages formosus" /mol_type="transcribed RNA" /db_xref="taxon:113540" /chromosome="18" gene 1..1690 /gene="topaz1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:108940511" misc_RNA 1..1690 /gene="topaz1" /product="testis and ovary specific PAZ domain containing 1, transcript variant X7" /db_xref="GeneID:108940511" ORIGIN
agatgatgaacagacatgaaactgcagttatctgagctgatgaaagcctgtcaagatattgaagagaatggcaccattcaccagcactccactctaagcctgagaggaacaagtcaacacacaagactcaaaaggccatgcactgtatgttgtgcggttaagcgtaccttctcagcaactgacaagcaggctacagacataccccaaaagcaaaagagaatccaaagtaaagaagtcaaaagtaagcaggcctcaaggaagctcattgatggactgaaaagatatcctgttgtaagtctgtgcaatatagcaaacattttcaggattcctgctgattctctaaatgtgagactcatcttatctaaggaactgcaaaggaagagcattcgttgtttcaaaagagaccacagtgatcgacaatgtgtggagtccttaccagggccttgtataaatgttgaaattagcaactgcatacatgtccatccaaactctaaagcttcttcagtaagccaaagtcctcaagatacaccagattttacaagctctccttcagaacaagaagtgagtgtccaggcagaaaatgcagagtcttttacattacatgaggagtcagttgcactggtttcatcagattttttgtggcactcaaagcagaaaaccccagatgatcccaatgtttgcagcgcctcaccgaccatctcagctaaaatggaccaagagaaaaatacatgtgttgttaaggagaacttgcagcttggggtaacgaagagcaggcaaaaacaaagtccttctttgaatgttttcaagaactttgagaaaaaacattcaggacctacagccactggtgtatctgagttccagaaactgcaggttgcttccaagaatgtacttgcttgctctttttcttcaggaaggtccgctgatgtgaagcctaaatgggaatcaagggagtttagttttccgcaggtaagcatggtgtgtgctaacctttcttcagatgatgaccatgacatcagcaacctgagttctgaggaagacctggtggatgatatctatccactgtgtggcgtgataatgtgtgacattagggatacccccaccggttctcccaaagagccttcttactccagaaaagaaggggcttctgggggcaagatggacttgatcagagcatatgaagaagatgctcttgttctggatgtaattcaagatgaccctgagttgtttggaaacatatctgaagaaaccacagagaaagagaacaaaaaatcacagccaccatctgatgtcaaaagagaaggctcaaaggactccccagtgacaaggaccaatcacagaattttatgggatggtaacgaaagcgatccgagggagtcaaaggtgaactcagaatgccttggttatccggacatcagcgctgaatggtatattaataatggtaagagaatgttttattatgtaagcctgctgtgtttgtctttattttcatttacatgaaatgcttatgcaaaggatggaacatggacatattaatttctgtgtctaagatttcaaatgcaatgtcaaggaggacagcagagctcaacagtgtgcaactgcgccgggttcttcggatggccgagttcaccgtaaggtttactgcaagtattacttcagcattcatcacaactgcttcaggaagccatgcttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]