2024-04-19 11:57:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001152030 462 bp RNA linear PRI 24-FEB-2017 DEFINITION PREDICTED: Microcebus murinus exo/endonuclease G (EXOG), transcript variant X12, misc_RNA. ACCESSION XR_001152030 VERSION XR_001152030.1 DBLINK BioProject: PRJNA285159 KEYWORDS RefSeq. SOURCE Microcebus murinus (gray mouse lemur) ORGANISM Microcebus murinus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Strepsirrhini; Lemuriformes; Cheirogaleidae; Microcebus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_033660.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Microcebus murinus Annotation Release 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..462 /organism="Microcebus murinus" /mol_type="transcribed RNA" /isolate="mixed" /db_xref="taxon:30608" /chromosome="1" /sex="pooled male and female" /tissue_type="liver; kidney" /note="three separate animals were used in this assembly: #8(Reference animal), 1886F (Citronella), 7006M (Rosehip)" gene 1..462 /gene="EXOG" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:105866813" misc_RNA 1..462 /gene="EXOG" /product="exo/endonuclease G, transcript variant X12" /db_xref="GeneID:105866813" ORIGIN
cagagaggtttgaagatgtttgggtagtatctggaccattgaccttacctcaaactagaagtgatggaaagaaagcagttagttatcaggcaatgaagcatatatgtgtttttattttggaggaagtgaaacaaatgaactggcatttattgagggctgtgtatgtcaggtggtatctgaggtcatccatgtgctttctctgatgtgcctgtttcaagaagagattgattccagacaattgaaacatacctgaagattctggcttggacattataaatgacctgacaagaaatcctgcagttggtcttggcagtgggacctccacgtgtgacagacagcagatggctgtggagttcccatgctgtgtgccatgtgattggtgatgacaatgtggcagtcccctcacacctttataaggtgatcctggcccgcagaagcccagtatctactgaacctctggca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]