GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-28 17:25:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_546584                861 bp    mRNA    linear   MAM 06-JAN-2021
DEFINITION  PREDICTED: Canis lupus familiaris claudin 7 (CLDN7), mRNA.
ACCESSION   XM_546584
VERSION     XM_546584.5
DBLINK      BioProject: PRJNA12384
KEYWORDS    RefSeq.
SOURCE      Canis lupus familiaris (dog)
  ORGANISM  Canis lupus familiaris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
            Canis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_006587.4) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 17, 2015 this sequence version replaced XM_546584.4.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Canis lupus familiaris Annotation
                                           Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..861
                     /organism="Canis lupus familiaris"
                     /mol_type="mRNA"
                     /isolate="Tasha"
                     /sub_species="familiaris"
                     /db_xref="taxon:9615"
                     /chromosome="5"
                     /sex="female"
                     /breed="boxer"
     gene            1..861
                     /gene="CLDN7"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 12 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 33 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:489466"
                     /db_xref="VGNC:VGNC:53320"
     CDS             1..636
                     /gene="CLDN7"
                     /codon_start=1
                     /product="claudin-7"
                     /protein_id="XP_546584.3"
                     /db_xref="GeneID:489466"
                     /db_xref="VGNC:VGNC:53320"
                     /translation="
MANSGLQLLGFALALVGWAGLVASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALSAALQATRALMVVSLVLGFLAMFVATMGMKCTNCGGDDKVKKARIAMTGGIIFIVGGLAALVACSWYGHQIVTDFYNPLVPMNIKYEFGPAIFIGWAGSALVILGGALLSCSCPGSESKAGYRAPRSYPKPNSAKEYV"
     misc_feature    10..546
                     /gene="CLDN7"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; pfam00822"
                     /db_xref="CDD:395662"
ORIGIN      
atggccaactcgggcctgcagctgctgggcttcgccctggccctggtgggctgggcgggcctggtggcgagcaccgccatcccgcagtggcagatgagctcgtacgcgggcgacaacatcatcacggcccaggccatgtacaaggggctgtggatggagtgcgtgacgcagagcaccggcatgatgagctgcaaaatgtacgactcggtgctggccctgtcggcggccttgcaggccacccgtgccctgatggtggtgtccctggtgctgggattcctggccatgtttgtggccacgatgggcatgaagtgtaccaactgtgggggagacgacaaagtgaagaaggcccgaatagctatgaccggaggcatcattttcattgtgggaggtcttgctgccttggtagcctgctcctggtacggccaccagattgtcacggacttctacaaccccctggtccccatgaatattaagtacgagtttggtcctgccatcttcattggctgggcagggtctgctctggtcattctgggaggtgccctgctctcttgctcctgtcctgggagcgagagcaaagctgggtaccgtgcaccccgctcctaccctaagcccaactctgccaaggagtacgtgtgagctgggacccccccccagccccagcctggcagcctctggtgtgcccaggtgctgaaatgacctggggggcagagctcagcccatgggtggggtgtggaactggagcctcgcctcatcaccccgcacaccatgtacagttcccagggtgggggtggggtggggtgggggagacaaaaagggaggatgtgctttttgtacagtaataaaaaaagtatgttttggaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]