2024-03-28 17:25:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_546584 861 bp mRNA linear MAM 06-JAN-2021 DEFINITION PREDICTED: Canis lupus familiaris claudin 7 (CLDN7), mRNA. ACCESSION XM_546584 VERSION XM_546584.5 DBLINK BioProject: PRJNA12384 KEYWORDS RefSeq. SOURCE Canis lupus familiaris (dog) ORGANISM Canis lupus familiaris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_006587.4) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Sep 17, 2015 this sequence version replaced XM_546584.4. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Canis lupus familiaris Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..861 /organism="Canis lupus familiaris" /mol_type="mRNA" /isolate="Tasha" /sub_species="familiaris" /db_xref="taxon:9615" /chromosome="5" /sex="female" /breed="boxer" gene 1..861 /gene="CLDN7" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 12 Proteins, and 99% coverage of the annotated genomic feature by RNAseq alignments, including 33 samples with support for all annotated introns" /db_xref="GeneID:489466" /db_xref="VGNC:VGNC:53320" CDS 1..636 /gene="CLDN7" /codon_start=1 /product="claudin-7" /protein_id="XP_546584.3" /db_xref="GeneID:489466" /db_xref="VGNC:VGNC:53320" /translation="
MANSGLQLLGFALALVGWAGLVASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALSAALQATRALMVVSLVLGFLAMFVATMGMKCTNCGGDDKVKKARIAMTGGIIFIVGGLAALVACSWYGHQIVTDFYNPLVPMNIKYEFGPAIFIGWAGSALVILGGALLSCSCPGSESKAGYRAPRSYPKPNSAKEYV"
misc_feature 10..546 /gene="CLDN7" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; pfam00822" /db_xref="CDD:395662" ORIGIN
atggccaactcgggcctgcagctgctgggcttcgccctggccctggtgggctgggcgggcctggtggcgagcaccgccatcccgcagtggcagatgagctcgtacgcgggcgacaacatcatcacggcccaggccatgtacaaggggctgtggatggagtgcgtgacgcagagcaccggcatgatgagctgcaaaatgtacgactcggtgctggccctgtcggcggccttgcaggccacccgtgccctgatggtggtgtccctggtgctgggattcctggccatgtttgtggccacgatgggcatgaagtgtaccaactgtgggggagacgacaaagtgaagaaggcccgaatagctatgaccggaggcatcattttcattgtgggaggtcttgctgccttggtagcctgctcctggtacggccaccagattgtcacggacttctacaaccccctggtccccatgaatattaagtacgagtttggtcctgccatcttcattggctgggcagggtctgctctggtcattctgggaggtgccctgctctcttgctcctgtcctgggagcgagagcaaagctgggtaccgtgcaccccgctcctaccctaagcccaactctgccaaggagtacgtgtgagctgggacccccccccagccccagcctggcagcctctggtgtgcccaggtgctgaaatgacctggggggcagagctcagcccatgggtggggtgtggaactggagcctcgcctcatcaccccgcacaccatgtacagttcccagggtgggggtggggtggggtgggggagacaaaaagggaggatgtgctttttgtacagtaataaaaaaagtatgttttggaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]