ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-01 05:22:25, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_077862540 1121 bp mRNA linear MAM 06-DEC-2025
DEFINITION PREDICTED: Canis aureus copper chaperone for superoxide dismutase
(CCS), transcript variant X3, mRNA.
ACCESSION XM_077862540
VERSION XM_077862540.1
DBLINK BioProject: PRJNA1372771
KEYWORDS RefSeq.
SOURCE Canis aureus (golden jackal)
ORGANISM Canis aureus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
Canis.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_135631) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_053574225.1-RS_2025_12
Annotation Pipeline :: NCBI Eukaryotic Genome Annotation
Pipeline (EGAP)
Annotation Software Version :: 10.5
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 12/03/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..1121
/organism="Canis aureus"
/mol_type="mRNA"
/isolate="CA01"
/db_xref="taxon:68724"
/chromosome="21"
/sex="male"
/tissue_type="muscle"
/dev_stage="adult"
/geo_loc_name="Austria"
gene 1..1121
/gene="CCS"
/note="copper chaperone for superoxide dismutase; Derived
by automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 2 Proteins, and 100% coverage of the annotated genomic
feature by RNAseq alignments, including 55 samples with
support for all annotated introns"
/db_xref="GeneID:144292377"
CDS 192..959
/gene="CCS"
/codon_start=1
/product="copper chaperone for superoxide dismutase
isoform X3"
/protein_id="XP_077718666.1"
/db_xref="GeneID:144292377"
/translation="
MTCQSCVDAVRTSLQGVAGIQSVKVQLENQMVLVQTTLPSQEVQALLESTGRQAVLKGMGSGLLQNLGAAVAILEGPGPVQGVVRFLQLTPERCLIEGTIDGLEPGLHGLHVHQFGDLTGNCNSCGDHFNPDGASHGGPKDSDRHRGDLGNVHAGTDGRAIFRIEDEQLKVWDVIGRSLVIDEGEDDLGLGGHPLSKVTGNSGERLACGIIARSAGLFQNPKQICSCDGLTIWEERGRPIAGEGRKEPAKPPAHL"
misc_feature 192..893
/gene="CCS"
/note="copper, zinc superoxide dismutase; Region:
PLN02957"
/db_xref="CDD:215516"
polyA_site 1121
/gene="CCS"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
agcaaagtgtggcttccgaagctccgcctccccgcgacggagttaggggtttgcccggcgctacctcagcgccgcggcagttcaggtcctcgggccggtgacggggtccgggatggcttcggactccgaggaccgcgggaccgcctgcacgcctgtccctgccggccttgcagctggagttcacagtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaaggggtggcaggcatccagagtgttaaagtgcagttggaaaaccagatggtcctggtgcagaccaccctgcccagccaagaggtgcaggcccttctggaaagcacagggcggcaggcagtactcaagggcatgggcagtggcctcctgcagaatctgggagcagcagttgccattctggagggccctggtcccgtgcaaggggtggtgcgcttcctacagctgacccctgaacgctgcctcattgaggggaccatcgatggcctggagcctgggctgcatggactccatgtccatcagtttggagacctcaccgggaactgcaacagctgcggggaccactttaaccctgatggagcatctcacgggggccctaaggactctgaccggcaccgtggggacctggggaatgtccatgctggcactgatggccgagccatcttcaggatagaggatgagcagctgaaggtatgggatgtgattggccgaagcctggtcatcgatgaaggagaagatgatctgggcctgggtggccatcccttatccaaggtcacaggaaactcaggagagaggttggcctgtggcatcatcgcacgctctgctggccttttccagaaccctaagcagatctgctcctgtgatggccttaccatctgggaggagcgaggccggcccattgctggtgagggacgaaaggagccagccaagccccctgcccacctctgaacatggcctcagcttcgggtttgttctcccagctgtgcactgtctacttccagagagaggggagggaggccctgcttgcccagtcctaggaggacttgggtacagggtgtgaaggttgctgtgatgttcccttgcaaattaaagttttattttcctacagaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]