GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-01 05:22:25, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_077862539            1124 bp    mRNA    linear   MAM 06-DEC-2025
DEFINITION  PREDICTED: Canis aureus copper chaperone for superoxide dismutase
            (CCS), transcript variant X2, mRNA.
ACCESSION   XM_077862539
VERSION     XM_077862539.1
DBLINK      BioProject: PRJNA1372771
KEYWORDS    RefSeq.
SOURCE      Canis aureus (golden jackal)
  ORGANISM  Canis aureus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
            Canis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135631) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_053574225.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/03/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1124
                     /organism="Canis aureus"
                     /mol_type="mRNA"
                     /isolate="CA01"
                     /db_xref="taxon:68724"
                     /chromosome="21"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="Austria"
     gene            1..1124
                     /gene="CCS"
                     /note="copper chaperone for superoxide dismutase; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 4 Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 63 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:144292377"
     CDS             138..962
                     /gene="CCS"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase
                     isoform X2"
                     /protein_id="XP_077718665.1"
                     /db_xref="GeneID:144292377"
                     /translation="
MASDSEDRGTACTLEFTVQMTCQSCVDAVRTSLQGVAGIQSVKVQLENQMVLVQTTLPSQEVQALLESTGRQAVLKGMGSGLLQNLGAAVAILEGPGPVQGVVRFLQLTPERCLIEGTIDGLEPGLHGLHVHQFGDLTGNCNSCGDHFNPDGASHGGPKDSDRHRGDLGNVHAGTDGRAIFRIEDEQLKVWDVIGRSLVIDEGEDDLGLGGHPLSKVTGNSGERLACGIIARSAGLFQNPKQICSCDGLTIWEERGRPIAGEGRKEPAKPPAHL"
     misc_feature    177..896
                     /gene="CCS"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
     polyA_site      1124
                     /gene="CCS"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gacgtgcgcgcgcaccaggaggctgagcaaagtgtggcttccgaagctccgcctccccgcgacggagttaggggtttgcccggcgctacctcagcgccgcggcagttcaggtcctcgggccggtgacggggtccgggatggcttcggactccgaggaccgcgggaccgcctgcacgctggagttcacagtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaaggggtggcaggcatccagagtgttaaagtgcagttggaaaaccagatggtcctggtgcagaccaccctgcccagccaagaggtgcaggcccttctggaaagcacagggcggcaggcagtactcaagggcatgggcagtggcctcctgcagaatctgggagcagcagttgccattctggagggccctggtcccgtgcaaggggtggtgcgcttcctacagctgacccctgaacgctgcctcattgaggggaccatcgatggcctggagcctgggctgcatggactccatgtccatcagtttggagacctcaccgggaactgcaacagctgcggggaccactttaaccctgatggagcatctcacgggggccctaaggactctgaccggcaccgtggggacctggggaatgtccatgctggcactgatggccgagccatcttcaggatagaggatgagcagctgaaggtatgggatgtgattggccgaagcctggtcatcgatgaaggagaagatgatctgggcctgggtggccatcccttatccaaggtcacaggaaactcaggagagaggttggcctgtggcatcatcgcacgctctgctggccttttccagaaccctaagcagatctgctcctgtgatggccttaccatctgggaggagcgaggccggcccattgctggtgagggacgaaaggagccagccaagccccctgcccacctctgaacatggcctcagcttcgggtttgttctcccagctgtgcactgtctacttccagagagaggggagggaggccctgcttgcccagtcctaggaggacttgggtacagggtgtgaaggttgctgtgatgttcccttgcaaattaaagttttattttcctacagaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]