GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-01 05:21:57, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_077173722            6411 bp    mRNA    linear   VRT 25-SEP-2025
DEFINITION  PREDICTED: Agelaius phoeniceus ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_077173722
VERSION     XM_077173722.1
DBLINK      BioProject: PRJNA1331850
KEYWORDS    RefSeq.
SOURCE      Agelaius phoeniceus (red-winged blackbird)
  ORGANISM  Agelaius phoeniceus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Passeriformes; Passeroidea; Icteridae; Agelaius.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135266) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_051311805.1-RS_2025_09
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/22/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6411
                     /organism="Agelaius phoeniceus"
                     /mol_type="mRNA"
                     /isolate="bAgePho1"
                     /db_xref="taxon:39638"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Millbrook, New York"
                     /lat_lon="41.775839 N 73.744242 W"
                     /collection_date="2020-06-05"
                     /collected_by="Melanie Couture, Jean-Nicolas Audet"
     gene            1..6411
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 4 Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 2 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:129134662"
     CDS             296..4651
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_077029837.1"
                     /db_xref="GeneID:129134662"
                     /translation="
MERKLDNKMKRELSYLATLNDRNISLVSIRKQQAARDVPELLIIGEKSKTASPVKASSNLQKEEKLLQSYSMGMTEVNTDERQALSNIVSPPGCELKPTMKHNFAFDNIGYEASSETMPSPPSQEHTVVVNIVGMTCQSCVQSIEGRISKVNGILRIKVSLEQNNAVIKYRRSEISPEQICQEILDMGFDANIAEEKLTTATVNLPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPANFGSDGLDPLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKTASPSGAFTYNVIRQPPQGTTHVAVIKIDGMTCNSCVQSIEGAVSQRQGVKNVVVSLAGSTGTIHYDPTVTSGEELRAAIEDMGFDASVLTGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRDPNAHNLSHKKEIQQWRKSFLYSLAFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILIVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVIKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRLLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGNSSAPLGDSGVIPLLESQGPSASQKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPLGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINRADEEQYI"
     misc_feature    680..868
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(698..706,713..715)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    935..1126
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(953..961,968..970)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1259..1447
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1568..1771
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1928..2119
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1946..1954,1961..1963)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2183..4324
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3176..3178,3182..3184,4253..4255)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3308..3316,3518..3520,3704..3712,3800..3802,
                     3920..3928,3986..3988,3995..3997,4004..4006,4061..4063,
                     4070..4072)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     polyA_site      6411
                     /gene="ATP7B"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
tgcagagatcagcagtgccggacgcagctgggaaggcacgagggatgccgattggtgggaaacatttgaactggcagggagagcaggtagctgagtgcagcaagcagcctacataaggatcacaggttgcatctgggatttcctgatgaatgcctaataagcacatggattagatgggcagaactcttcaagctgttgtaaatgtagctgaaagaagcgtggcttggaggacaacaaataactgctctcgtgaaacttttttttggcattgcaatatttaaagcccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctacttagctactttaaacgacagaaacatatccttggtgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagacggcatctccggtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccatgggaatgacagaagtcaatacagatgaaaggcaggctttgtccaacatcgtttctcctcctggttgtgagctgaagcctacaatgaagcataattttgcttttgacaacataggctatgaggcaagctctgaaaccatgccctctccaccttcccaagagcatactgtggtagtcaacattgtgggaatgacctgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaacggcattttgagaattaaagtctcccttgaacagaacaacgctgttatcaagtatcggcggtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagctgaagagaagttgacaacagcaactgtaaatttgccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcacggtgtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgcttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtacgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacccgcaaattttgggagtgatgggctggatccactggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagcccagatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtgagcctccttagtggttcagaagcaaataaaacagcatctccctcaggtgctttcacatacaatgtcatcagacagccaccacaaggcacgacacatgtggctgttattaagattgatggcatgacctgcaattcttgtgtccagtccatagaaggggctgtatcacagaggcagggagtgaagaatgtagtagtttctctagctggcagtactgggaccatacactatgatccaactgtcactagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtgctgacaggaattgtttcagtgttagtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagatccaaatgcacataacctgagtcataaaaaggaaatacagcagtggaggaaatctttcttgtacagcctagcatttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtcctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttacgtgcaagcttacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgcgtgatcctgatagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcgctcggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgacccttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcaaaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgacggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtaaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcattccaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcgcagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaacggggaccatcacctatggagttcctaaagtcatgaggctgcttttgatgggagacacagctgtgctccccctgaagaaagtgctggctgttgttggtacagcagaggccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcaccgacttccaggcagtcccaggctgtggtatcagctgcaaggttggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactgggaacagcagcgctcctctgggagatagtggagttatcccactcttggaatcacaaggtccatcagcttctcagaaatactcggtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtgcattgtgtggaatgattgccatagcagacactgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcagaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggctgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgtccttatccgaaatgatttgctggatgtagttgccagtattcacttatccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctcttggcctcgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactgcagctgaaatgttacaagaagccggacacagaaagttacgaagcgcaagctcaaggccgcatgaagccactcactccttctcaaatcagtgttcacattggaatggacgataggaggagggactcttccaaaccatctccttgggaccagacaagccaagtgtccctctcctccctggcttcagacaggctgccaagacacaatggcttcatccaggaggaagggggcaagtggtcattgctcataaacagagcggatgaggagcagtacatctgaagctctggacacttagtgcagggggaaatgttcctcctccccagccaggggagggactgacttacttcatcagcagcttcagtgttgtaagtgaagtattccttcagctcataagacaactgcaactcagctcagcgttgggttgtatggattgtggatttttttcaggtcaccagttatttctagttatggaaataatctgtgccactgtaatgaactggcttgtttgcacacagcatttagtgaaataatgtaaaattgtaatttgcagagtctaaaagagtttctctgtgactctttgctaggaaccaaatttcatacttttcaatctgtcaatatttattacttcaagaccacatgaagcaagagtattttcagagctgccaaatattaatttgtgtctaaatgaaattatcaatggcataagggactatgtggtcagaatttgaatttttacacagaatcctaactagtcatgtcactctgggaacactttgtatttatggcatctcctgggaccaaaaatactttgttagttcacctgcttcaactctctgaaaggtctttttcaaagattttcactgctttgaggtattgcatccttttgatgcacatttctactgctctctttgattttctcttttgctccatatgagcccctttcccctttttcttgcacaagagatcttctatgagttatcattatgtttacagatatttctatttgggacaaactcctttaagtcaccaggaacctttccattccagttgaaatccataaaggcagagcagttcctggtcccagttatccaagataccttgctggaccccagggagctcctcagagttgggcagttgtctgtctcttttctctgacagagtgaagaatttatgccagtgtgggcaaaggtggtatttaccttggcatgactgagcagaactagcactggtgagactccagtgtagctgaacagagggagattattgcataacttaaccccagcttgctggttgcttaaaatgcagctaaaattttatattataaaggtggaaaatggccttaaagtgggcttctatttgccatcatatgaataaatgacaggacctcaactaagaaaatttgtaatttaaatttgtatttatttttttgcattggttttagttcccctctttacttcaatgagaaatcaaagtactggacaacccttttttgctttagcatctttaccaaagcttgcagtaacttcatccctgtggatgtcagattcaccccttaacactttttagagtcaggacagtaggaatcaacagttttggtgcactggatgcagttccagagtgccgtgttgtccagctgtgggactctgatgtaagcagagttttatagtcaaagaaatactttgctaaacaacatgaaataattgcttcttttcattgactgaaatatagagctgtttctaacatgagttcaaatactgcttctcctaatgtaaaaatgaaaaacaagtcggagaggaaaagaattgttcttaaaacatttgatgagtcttcccattttctcagcactgtcttaaatataattacaaatcagttttaaaactctatataagtagagattactttcacagcacacatacttttcaaacatgccataggtgcatgtccgcgtgggaaagagggtctgaagttttactgttctgtattttcttaccagtccttacagtaaaaatatgctttggtttttaaaaaaaataaacaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]