GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-29 11:12:07, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_071540880            1127 bp    mRNA    linear   VRT 24-FEB-2025
DEFINITION  PREDICTED: Centroberyx affinis homeobox protein Meis1-like
            (LOC139662238), mRNA.
ACCESSION   XM_071540880
VERSION     XM_071540880.1
DBLINK      BioProject: PRJNA1226274
KEYWORDS    RefSeq.
SOURCE      Centroberyx affinis (redfish)
  ORGANISM  Centroberyx affinis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Berycimorphaceae; Beryciformes; Berycidae;
            Centroberyx.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027281619) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_046629955.1-RS_2025_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/21/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1127
                     /organism="Centroberyx affinis"
                     /mol_type="mRNA"
                     /isolate="AG114_WGS23_722 - 3"
                     /db_xref="taxon:166261"
                     /chromosome="Unknown"
                     /tissue_type="gill"
                     /dev_stage="subadult"
                     /ecotype="Tasmania"
                     /geo_loc_name="Australia: Bass Strait, Tasmania"
                     /collection_date="2023"
     gene            1..1127
                     /gene="LOC139662238"
                     /note="homeobox protein Meis1-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 24
                     Proteins"
                     /db_xref="GeneID:139662238"
     CDS             171..1127
                     /gene="LOC139662238"
                     /codon_start=1
                     /product="homeobox protein Meis1-like"
                     /protein_id="XP_071396981.1"
                     /db_xref="GeneID:139662238"
                     /translation="
MAQRYEDLAHYGLEGVGGVYGDPHHAARSLQAVHLNPAGPYPPHQYAHPAHPAHPAHPGMGPAANDAVKRDKDAIYGHPLFPLLALIFEKCELATCTPRESGVAGGDVCSSDSFNEDIAVFSKQIRSEKPLFSSNPELDNLMIQAIQVLRFHLLELEKVHELCDNFCHRYISCLKGKMPIDLVIDDRDGNKSDSEEFSRSSGNIDQISWSRDHDDAASIRSAGTPGPSSGGHTSHSGDNSSEQGDCLDNGVASPSTGDDDDPDKEKRHNKKRGIFPKVATNIMRAWLFQHLTHPYPSEEQKKQLAQDTGLTILQVNNW"
     misc_feature    483..737
                     /gene="LOC139662238"
                     /note="N-terminal of Homeobox Meis and PKNOX1; Region:
                     Meis_PKNOX_N; pfam16493"
                     /db_xref="CDD:465140"
     misc_feature    1029..>1124
                     /gene="LOC139662238"
                     /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920"
                     /db_xref="CDD:428673"
ORIGIN      
gtgagtgtgagtgtgtgtgtgtgtgtgtgtgttttctatccgttggactttacaccgtcggtccgtctgagacacacacggaattattgatctctcctccggtaccgggagttggatgtgtattctgccccgcagcagggaagcggagtcgggctggagagaccgggccgatggcgcaacggtatgaagacctggcccactacgggctggagggggtggggggggtgtacggcgacccccaccacgccgcccgctccctgcaggccgtccacctgaaccccgccggcccgtacccgccgcaccagtacgcccaccccgcccaccccgcccaccccgcccaccccggcatgggccccgccgccaacgacgccgtcaagagagacaaagacgccatttacggtcatcccttgttccctctgctcgcactgatctttgaaaaatgtgaattagcgacctgcacgccgagagagagcggcgtggccgggggagacgtctgctcctcggactccttcaacgaggacatcgcggtgttttccaagcagatccgatcagagaaacctttattttcatcaaacccagagttggataatttgatgattcaggcgatccaggtgttgcggttccacctcctggagctcgagaaggttcacgaactttgcgataatttctgtcatcgatacatcagctgtctgaaggggaagatgccgatcgatctggtgatcgacgacagagacggaaacaagtccgacagcgaggagttcagcagatcatcagggaatatcgatcagatctcgtggagcagagatcacgacgacgcggcgtcgatccggtcggccgggacgccgggcccgtccagcggcgggcacacgtcccacagcggggacaacagcagcgaacaaggtgactgcctggataacggcgtggcgtctcccagcacgggggacgacgacgaccccgacaaggagaagcggcacaacaagaagagaggcatcttccccaaagtggcgaccaacatcatgcgggcgtggctcttccagcacctgacccacccatacccgtcggaggagcagaagaagcagctagcgcaggacaccggcctcaccatcctgcaggtcaacaactggtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]