2025-04-03 19:42:50, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_069630103 1206 bp mRNA linear VRT 15-NOV-2024 DEFINITION PREDICTED: Ambystoma mexicanum tropomyosin alpha-1 chain-like (LOC138514687), mRNA. ACCESSION XM_069630103 VERSION XM_069630103.1 DBLINK BioProject: PRJNA1165261 KEYWORDS RefSeq; includes ab initio. SOURCE Ambystoma mexicanum (axolotl) ORGANISM Ambystoma mexicanum Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Caudata; Salamandroidea; Ambystomatidae; Ambystoma. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090936) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_040938575.1-RS_2024_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/03/2024 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 38% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1206 /organism="Ambystoma mexicanum" /mol_type="mRNA" /isolate="Mex_15411" /db_xref="taxon:8296" /chromosome="12" /sex="female" /tissue_type="tail tip" /geo_loc_name="USA: Kentucky, University of Kentucky" /collection_date="2023-02" gene 1..1206 /gene="LOC138514687" /note="tropomyosin alpha-1 chain-like; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:138514687" CDS 1..1197 /gene="LOC138514687" /codon_start=1 /product="tropomyosin alpha-1 chain-like" /protein_id="XP_069486204.1" /db_xref="GeneID:138514687" /translation="
MREAIKGQNTTVDPDTRPRHYDSAKMGKSDKSQRKLTFETGSIVKTPKANERQGSPGGSMHSEDDPAQSTDIREILLELKAGIGNIDSKLISLSTKVDQLQHRLDKHGDRLDNAEQRISDVEDNISSLSTKIIKTLKSTDESIKVPTDRVVSLHEKLLVVKKEFEVSVPPVVKSSTLETEIQEQVGSVTDFETKAQLSEHEIQEQMKSLTDLEPKAQLSEHEIQEQMKSLTDLEPKAQLSEHEIQEQMKSLTDLEPKAQLTEDEIQEEVESATTVEPKTRLSEHEFQEQKASVTDFEQKTLLSEHEHEFEEQVGSTTDFEPTTPVNEKVLLIECCTEVEALLSNTLDVRPLNAVPFEVSLLSINSLLELFNTAHGGIIIGGSLFEWIITIFTKDFVSP"
ORIGIN
atgagggaagcaattaaggggcaaaacacaacagttgatcctgatacccggcccaggcactacgactccgccaagatgggtaaatcagataaatctcagaggaagctgacatttgagacagggtccattgtcaaaaccccaaaagcaaacgagagacaggggagtccaggagggtccatgcactcagaagacgaccccgctcaatccaccgacatcagagaaattctgcttgaactaaaagcagggattggcaacattgacagcaaactcatctccttgtccaccaaagtagaccagctacaacatcgcttggacaaacatggggacagactggacaatgccgaacaacgaatctccgatgtcgaagacaacatatcctccctgtccaccaagataatcaagactctgaaaagtactgatgagtccattaaagttccgacagacagagttgtttcattgcatgagaaattgttggttgtgaaaaaagaatttgaagtctcagtgccaccagtggttaaatcttctactctggaaactgaaattcaagaacaagtggggtctgtaaccgattttgaaacaaaagcacaactcagtgagcatgaaattcaagaacaaatgaagtctctaactgaccttgaaccaaaagcacaactcagtgagcacgaaattcaagaacaaatgaagtctcttactgaccttgaaccaaaagcacaactcagtgagcacgaaattcaagaacaaatgaagtctctaactgaccttgaaccaaaagcacaactcactgaagatgaaattcaagaggaagtcgaatctgcaaccactgttgaaccaaagacacgacttagtgaacatgaatttcaagaacaaaaggcgtctgtaaccgactttgaacaaaaaacattacttagtgaacatgaacatgaatttgaagagcaagtggggtctacaaccgatttcgaaccaacaacgccagtcaatgaaaaggtgttactgatagagtgttgcacagaagtggaagcattgttgtcgaatacacttgatgtaagaccactaaatgcggttccatttgaggtctcattgctctccataaacagtttgttggaactgttcaacacagctcatggtggtatcatcattggaggaagcctatttgaatggatcataactattttcacaaaagattttgtttcaccgtaaaggttttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]