GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-03 19:45:51, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_068601832             877 bp    mRNA    linear   VRT 19-SEP-2024
DEFINITION  PREDICTED: Clinocottus analis polycystin-2-like protein 1
            (LOC137803399), mRNA.
ACCESSION   XM_068601832
VERSION     XM_068601832.1
DBLINK      BioProject: PRJNA1162142
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Clinocottus analis (woolly sculpin)
  ORGANISM  Clinocottus analis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Cottioidei; Cottales;
            Cottidae; Clinocottus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027176213) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_023055335.1-RS_2024_09
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/18/2024
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 2% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..877
                     /organism="Clinocottus analis"
                     /mol_type="mRNA"
                     /isolate="CAN_PGR_092001"
                     /db_xref="taxon:304258"
                     /chromosome="Unknown"
                     /tissue_type="fin"
                     /dev_stage="adult"
                     /lat_lon="36.635559 N 121.926191 W"
                     /collection_date="2020-09-17"
                     /collected_by="Daniel Wright"
     gene            1..877
                     /gene="LOC137803399"
                     /note="polycystin-2-like protein 1; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:137803399"
     CDS             53..877
                     /gene="LOC137803399"
                     /codon_start=1
                     /product="polycystin-2-like protein 1"
                     /protein_id="XP_068457933.1"
                     /db_xref="GeneID:137803399"
                     /translation="
MGPFIVMLGNIIGDVMRFLFLYAEIFVPYACSFWIMFGGSSSVPSMQSVSGLLFSLYRITLVDEYEYAAMATVDPVMAPLLCGTFLAASSILCVNLLVALLTDTFQRVHDNSQANAVMQQASVILQVEESMPLLRRFYDNQYISNHCAPLTDAHNNDITTNSRYHGEMGRITTQIKETLDQFLVLQRDLDSAGGSGDQTLNQDQNRDQTLNQDQNRDQTLNQDQNRDQTLNQDQELQAIRAELKQLRTLVQQLVENRTPVQQMENQKEDNEMKQ"
ORIGIN      
gtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgcaggttgatgggtccgttcattgtcatgttgggtaacatcatcggggacgtgatgcgtttcctgttcctgtacgctgagatcttcgtcccctacgcctgcagcttctggatcatgttcggaggctcctcctcagttcccagcatgcagtctgtctccggcctgctgttcagtctgtaccgcatcactctggtggacgagtacgagtatgctgccatggcaacagtggaccctgttatggctcctctactctgtgggacgtttctggctgcgtcctccatcttgtgtgtcaacctgctggtggccctgctcacagacaccttccagagggttcatgataactcccaggctaacgcagtgatgcaacaggcgtccgtcatcctgcaggtggaggaatccatgcccctcctccgccgtttctatgacaaccagtacatctccaaccactgtgcaccgctgaccgacgcccacaacaatgacatcaccactaactcccgttaccatggcgagatgggacgcatcactacgcagattaaagagaccctggatcagttcctggtcctgcagagagacctggactcagctggaggttctggagaccagaccttgaaccaggaccagaacagagaccagaccttgaaccaggaccagaacagagaccagaccttgaaccaggaccagaacagagaccagaccttgaaccaggaccaggagctccaggctatccgcgcagagctgaagcagctccggactctggtccagcagctggtggagaaccggactccagtccagcagatggagaaccagaaggaggacaatgaaatgaaacaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]