2024-11-03 22:17:52, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_065952331 1524 bp mRNA linear VRT 24-JUN-2024 DEFINITION PREDICTED: Labrus bergylta probable inactive protein kinase DDB_G0270444 (LOC136178463), mRNA. ACCESSION XM_065952331 VERSION XM_065952331.1 DBLINK BioProject: PRJNA1126594 KEYWORDS RefSeq; includes ab initio. SOURCE Labrus bergylta (ballan wrasse) ORGANISM Labrus bergylta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Labriformes; Labridae; Labrus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_027077286) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963930695.1-RS_2024_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/21/2024 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1524 /organism="Labrus bergylta" /mol_type="mRNA" /db_xref="taxon:56723" /chromosome="Unknown" gene 1..1524 /gene="LOC136178463" /note="probable inactive protein kinase DDB_G0270444; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:136178463" CDS 1..1524 /gene="LOC136178463" /codon_start=1 /product="probable inactive protein kinase DDB_G0270444" /protein_id="XP_065808403.1" /db_xref="GeneID:136178463" /translation="
MRTSCRASCRTSCRTSCRTSCRTSCRTSCRTSLQDELQDELQDELQEEDELQDELQDELQDELQDELQDELQDEDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELKDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELKDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDEDELQDELKDELKDELQDELQDELQDELKDELQDELQDELQDELKDELKDELQQKLPCTP"
ORIGIN
atgaggacgagctgcagggcgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagcttgcaggacgagttgcaggacgagctgcaggacgagctgcaggaagaggacgagttgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgaactgcaggacgaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaagacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgaactgcaggacgaactgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagctgcaggacgagctgcaggacgaactgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagctgcaggacgaactgcaggacgagttgcaggacgaactgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgaactgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggatgaggacgagttgcaggacgagctgaaggacgagctgaaggacgagttgcaggacgagttacaggacgaactgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgaactgcaggacgagctgaaggacgagctgaaggacgagttgcaacagaagctcccctgcactccataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]