GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 18:49:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_061078957            1176 bp    mRNA    linear   VRT 21-NOV-2023
DEFINITION  PREDICTED: Limanda limanda vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_061078957
VERSION     XM_061078957.1
DBLINK      BioProject: PRJNA1040927
KEYWORDS    RefSeq.
SOURCE      Limanda limanda (common dab)
  ORGANISM  Limanda limanda
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei;
            Pleuronectidae; Limanda.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083645) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_963576545.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/17/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1176
                     /organism="Limanda limanda"
                     /mol_type="mRNA"
                     /db_xref="taxon:27771"
                     /chromosome="10"
     gene            1..1176
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 4
                     Proteins"
                     /db_xref="GeneID:133011268"
     CDS             1..1176
                     /gene="vimr2"
                     /codon_start=1
                     /product="peripherin"
                     /protein_id="XP_060934940.1"
                     /db_xref="GeneID:133011268"
                     /translation="
MAMLRVSSYRRLFEEETWGRSGGLSSPCAGQYQASVRRAAADKCDCDCEQLDFVAAKSLNKEGLTRFALDRSVIAALNDRLVGLIELARCFEEENDSLECQIVELEEKQSSRPAASSSITSAVAPPDFSLDAVVERLRRERDEILCDTEELHKELERLQSSYEELAQQRVFYLQEQQDVAEVVDAVTAECLALREQVAIYEEQLANMEARHKTEVESLQDPADWTTGAAAALGFCSPDMTPVLDVKEFYCQLAESLQFGAASSAAVRGGDRKQLEVGAAEGSKVTDSPKIQDVGELKMLISELQKEIVELEKYNEELEDEVEMKTSAHMDEIADLKFTMDEMRQQEADFQVQMKEQCEDYKELLSEKMARDMEIVAYRSLLEDEEERLCDL"
ORIGIN      
atggccatgctcagggtgtcttcctaccggaggctgtttgaggaggaaacgtggggtcgaagtggagggttgagttcaccgtgtgctgggcagtatcaggcctctgtcaggcgtgcggccgccgacaagtgcgactgtgactgtgagcagctggactttgtcgccgccaagtctctgaacaaggagggtctgacccggttcgccctggaccgcagcgtcatcgctgccctcaacgaccgcctggtcggccttatagagctggctcgttgtttcgaggaggagaatgattcgctggaatgtcagattgtggagctggaggagaagcagagcagtcgcccagccgcatcctcctccatcacctccgccgtggctccacctgacttcagcctggatgcagtggtggagagactgcgcagggagcgggacgagattctgtgcgacaccgaggagctgcacaaggagctggagcgtctgcagagcagctacgaggagctggcacagcagagagtcttctacctgcaagagcagcaggatgtggctgaggtcgtggatgctgtgacagcagagtgtctggcgctgagggagcaagtggctatctacgaggagcagctggccaacatggaggcccggcacaagacggaggtggagagtctgcaggatccagccgactggaccacaggagcagctgcagctcttggattctgcagcccggacatgactccggtcctggatgtgaaggagttctactgccagctggctgagagtctccagttcggagctgcctcctctgctgcagtacgcggtggtgatcgaaaacaactggaagtgggagctgccgaagggtcaaaggtcacagactcgccaaagatacaggacgtcggtgagctgaagatgctgatttccgagctacaaaaggagattgtggagcttgagaagtataatgaggagctggaggatgaggtggagatgaagacatctgcacacatggacgagattgctgatttgaagttcaccatggatgagatgcggcagcaggaggccgacttccaggtacagatgaaggagcagtgtgaagactacaaggagctgctcagtgagaagatggccagagacatggagattgttgcctacaggagtctgttggaggatgaagaggagaggctgtgcgacctgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]