ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 18:49:06, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_059210868 1192 bp mRNA linear PLN 30-AUG-2023 DEFINITION PREDICTED: Cryptomeria japonica protein argonaute 12-like (LOC131062786), transcript variant X5, mRNA. ACCESSION XM_059210868 VERSION XM_059210868.1 DBLINK BioProject: PRJNA1009076 KEYWORDS RefSeq. SOURCE Cryptomeria japonica (Japanese cedar) ORGANISM Cryptomeria japonica Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Pinopsida; Pinidae; Conifers II; Cupressales; Cupressaceae; Cryptomeria. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_081413) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_030272615.1-RS_2023_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/25/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1192 /organism="Cryptomeria japonica" /mol_type="mRNA" /db_xref="taxon:3369" /chromosome="9" /geo_loc_name="Japan" /collection_date="2017-05-09" gene 1..1192 /gene="LOC131062786" /note="protein argonaute 12-like; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:131062786" CDS 737..1144 /gene="LOC131062786" /codon_start=1 /product="protein argonaute 12-like isoform X3" /protein_id="XP_059066851.1" /db_xref="GeneID:131062786" /translation="
MNLPYFIGNALRMDPRDVNAILSRNDSNGDSMRSRLKRLLNGLHVETTHIKYGYRNKSMTDVPVDALVFDSNGEQLIVTDYFQKQYNIRLGFREFPAIEAGSKDNFQRLKLVARIIISTFPLRLLLKIMAIQLVY"
misc_feature 794..1051
/gene="LOC131062786"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
ORIGIN
tctaggtcctgtgttcggatggtccttttagaattttagctattaattttccggagttttgtttttgtatgtaaaaagtcttgcaaaacgttgcggcttcaattctctaaacagaaatgagcaaatgatcccttgacttctcgtttgtttccgcttgatgtttgtttcctggctctggtcgagggttcaatgcttgctggtgtaagaatttgctgcctttttgagcacttaaattttgtgtggttaggtcgcggcttcgaattttaataacatgaaaaaaatggagcatccacgacgctcacaaaggacgttgctgctgatacgcttcttcttaggccgcctgctgttctttctcttcctcccgtgaagttaagtttagccacacagcctggctatggcgtaaatgtcacccggattttcctcctagctaaccatttctgggttcgctttcagaacaacgagctctatcagtacgatcctcctaagggttgcagttacagcgtcataatggaaacattcaaacagcaggcgatactttgaaaaatgccatacctgcatatgacggacacaagagtctctacacggccaagcccttaggcaatcttgttgagcttgaagtcctcttatcgcacggccggggggagatttaagaagacattgctgcaattctcttctacgagcctatggacttgcctcacttcattggcaatgccttaagaatggatccttgagatgtatgaacttgccttacttcattggcaatgccttaagaatggatcctcgagatgtaaatgctatattgtctagaaatgactctaatggtgattcaatgcgatcaagattgaaaaggttactgaatggtctgcatgtagaaactactcacatcaaatatggttatcgcaataagagcatgactgatgtgcctgtggatgctttagtatttgatagcaatggagagcaattgattgttacagattatttccaaaagcaatacaatatacgccttggcttcagagaatttccagcaattgaagctggtagcaaggataatttccagcgattgaagctggtagcaaggataataataagtacattcccattgaggttacttctcaaaatcatggcaatccagttggtctattgaatctatcttgcttgcctccacatgaaagaagagacaaaactaagaagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]