GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-05 18:49:06, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_059210868            1192 bp    mRNA    linear   PLN 30-AUG-2023
DEFINITION  PREDICTED: Cryptomeria japonica protein argonaute 12-like
            (LOC131062786), transcript variant X5, mRNA.
ACCESSION   XM_059210868
VERSION     XM_059210868.1
DBLINK      BioProject: PRJNA1009076
KEYWORDS    RefSeq.
SOURCE      Cryptomeria japonica (Japanese cedar)
  ORGANISM  Cryptomeria japonica
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Pinopsida; Pinidae; Conifers II; Cupressales;
            Cupressaceae; Cryptomeria.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_081413) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030272615.1-RS_2023_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/25/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1192
                     /organism="Cryptomeria japonica"
                     /mol_type="mRNA"
                     /db_xref="taxon:3369"
                     /chromosome="9"
                     /geo_loc_name="Japan"
                     /collection_date="2017-05-09"
     gene            1..1192
                     /gene="LOC131062786"
                     /note="protein argonaute 12-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:131062786"
     CDS             737..1144
                     /gene="LOC131062786"
                     /codon_start=1
                     /product="protein argonaute 12-like isoform X3"
                     /protein_id="XP_059066851.1"
                     /db_xref="GeneID:131062786"
                     /translation="
MNLPYFIGNALRMDPRDVNAILSRNDSNGDSMRSRLKRLLNGLHVETTHIKYGYRNKSMTDVPVDALVFDSNGEQLIVTDYFQKQYNIRLGFREFPAIEAGSKDNFQRLKLVARIIISTFPLRLLLKIMAIQLVY"
     misc_feature    794..1051
                     /gene="LOC131062786"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
ORIGIN      
tctaggtcctgtgttcggatggtccttttagaattttagctattaattttccggagttttgtttttgtatgtaaaaagtcttgcaaaacgttgcggcttcaattctctaaacagaaatgagcaaatgatcccttgacttctcgtttgtttccgcttgatgtttgtttcctggctctggtcgagggttcaatgcttgctggtgtaagaatttgctgcctttttgagcacttaaattttgtgtggttaggtcgcggcttcgaattttaataacatgaaaaaaatggagcatccacgacgctcacaaaggacgttgctgctgatacgcttcttcttaggccgcctgctgttctttctcttcctcccgtgaagttaagtttagccacacagcctggctatggcgtaaatgtcacccggattttcctcctagctaaccatttctgggttcgctttcagaacaacgagctctatcagtacgatcctcctaagggttgcagttacagcgtcataatggaaacattcaaacagcaggcgatactttgaaaaatgccatacctgcatatgacggacacaagagtctctacacggccaagcccttaggcaatcttgttgagcttgaagtcctcttatcgcacggccggggggagatttaagaagacattgctgcaattctcttctacgagcctatggacttgcctcacttcattggcaatgccttaagaatggatccttgagatgtatgaacttgccttacttcattggcaatgccttaagaatggatcctcgagatgtaaatgctatattgtctagaaatgactctaatggtgattcaatgcgatcaagattgaaaaggttactgaatggtctgcatgtagaaactactcacatcaaatatggttatcgcaataagagcatgactgatgtgcctgtggatgctttagtatttgatagcaatggagagcaattgattgttacagattatttccaaaagcaatacaatatacgccttggcttcagagaatttccagcaattgaagctggtagcaaggataatttccagcgattgaagctggtagcaaggataataataagtacattcccattgaggttacttctcaaaatcatggcaatccagttggtctattgaatctatcttgcttgcctccacatgaaagaagagacaaaactaagaagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]