GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 06:29:48, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_058415586            1376 bp    mRNA    linear   VRT 23-JUL-2023
DEFINITION  PREDICTED: Hemibagrus wyckioides claudin-4-like (LOC131369125),
            mRNA.
ACCESSION   XM_058415586
VERSION     XM_058415586.1
DBLINK      BioProject: PRJNA996633
KEYWORDS    RefSeq.
SOURCE      Hemibagrus wyckioides
  ORGANISM  Hemibagrus wyckioides
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Bagridae; Hemibagrus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_080727) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_019097595.1-RS_2023_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/20/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1376
                     /organism="Hemibagrus wyckioides"
                     /mol_type="mRNA"
                     /isolate="EC202008001"
                     /db_xref="taxon:337641"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="sexual maturity"
                     /linkage_group="LG18"
     gene            1..1376
                     /gene="LOC131369125"
                     /note="claudin-4-like; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 317 Proteins"
                     /db_xref="GeneID:131369125"
     CDS             86..1207
                     /gene="LOC131369125"
                     /codon_start=1
                     /product="claudin-4-like"
                     /protein_id="XP_058271569.1"
                     /db_xref="GeneID:131369125"
                     /translation="
MVSAGMQMLGAALGVIGWIGVIVVCALPMWRVTAFIGNNIVTSQIQWEGIWMNCVVQSTGQMQCKVYDSMLALSSDLQAARALTVISIVVGIMGILLAMAGGKCTNCIEDEKSKGKVAVVAGIIFIISGVLCLIPVCWTAQTVIRDFYNPLVNQAQKRELAKMVSQGLQILGVLLSMTGWIGTIVTCALPMWRVTAFIGANIVTAQIIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARAMVVISIIVGIFGVLMAVVGGKCTNCMEDESAKAKACIVSGVIFLIAAFLILIPVSWSAQTLIRDFYNPLVIEAQRRELGASLYIGWGSGALLLLGGGLLCWNCPPKENQPYTAAKFAPARSLSPGMNYV"
     misc_feature    98..538
                     /gene="LOC131369125"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    584..1069
                     /gene="LOC131369125"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
ORIGIN      
ttactgggttcgtcagatacctgccaagaaaccacagagctcttttggaacagcacaagaggaagtgaagagacgtctgagcgaaatggtgtcagctgggatgcagatgctgggcgccgccctgggtgtcatcggctggatcggcgttatcgtggtctgtgctctgcccatgtggagggtcacagctttcatcggcaacaacatcgtcacgtcgcagatccagtgggaaggcatatggatgaactgtgtggttcagagcacggggcagatgcagtgcaaggtgtacgactccatgctggcgctgagctcggatctccaagctgcccgcgctctcacggtcatctccatcgtggtgggcatcatgggcatcctgctggccatggctggaggaaaatgcaccaactgcatagaggatgagaagtccaaagggaaggttgctgtggtagcgggcatcatcttcattatttctggggtattgtgcctgatccctgtgtgctggactgcccaaaccgtcatcagggacttctacaacccactggtcaaccaggcgcagaagagagagctggcaaaaatggtatcccaaggcctccagatcttaggtgttttgctgtctatgacagggtggatagggacgatcgtcacttgcgctctgccgatgtggagggtgacagcgttcatcggagcgaacatcgtcacggcgcaaatcatctgggagggtttatggatgaactgtgtggttcagagcacgggacagatgcagtgtaaggtctatgactccctgttggcgcttcctcaggaccttcaggccgcccgagccatggtcgtcatctccatcatagtgggcattttcggtgtgctcatggctgtggtcggaggaaagtgcaccaactgcatggaggacgaatcggcaaaagctaaagcctgcattgtctcgggggtgatcttcctcatcgctgccttcctcatcctcattcctgtcagctggtctgcccagactctcatcagggacttctacaaccccctggtgatagaggctcagcgtcgagagttaggagcttctctgtatattggctggggatctggagctctcctgctgctggggggagggctgctttgctggaattgccccccgaaggaaaaccagccgtatacagcagccaaatttgccccagctagatcattatccccagggatgaattatgtgtaagcaacatggcgcaggtttccatgagaactctgaacaaaagtggactcatatatcgtgtctatgtctatgtctccggaaaggcatgtattttcttttgttttgagatcagatttattttcctattatgtgattgtagaagcactaataataatgatgagatggacatttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]