2024-09-08 11:40:39, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS XM_058415586 1376 bp mRNA linear VRT 23-JUL-2023 DEFINITION PREDICTED: Hemibagrus wyckioides claudin-4-like (LOC131369125), mRNA. ACCESSION XM_058415586 VERSION XM_058415586.1 DBLINK BioProject: PRJNA996633 KEYWORDS RefSeq. SOURCE Hemibagrus wyckioides ORGANISM Hemibagrus wyckioides Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes; Bagridae; Hemibagrus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_080727) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_019097595.1-RS_2023_07 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 07/20/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1376 /organism="Hemibagrus wyckioides" /mol_type="mRNA" /isolate="EC202008001" /db_xref="taxon:337641" /sex="female" /tissue_type="blood" /dev_stage="sexual maturity" /linkage_group="LG18" gene 1..1376 /gene="LOC131369125" /note="claudin-4-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 317 Proteins" /db_xref="GeneID:131369125" CDS 86..1207 /gene="LOC131369125" /codon_start=1 /product="claudin-4-like" /protein_id="XP_058271569.1" /db_xref="GeneID:131369125" /translation="
MVSAGMQMLGAALGVIGWIGVIVVCALPMWRVTAFIGNNIVTSQIQWEGIWMNCVVQSTGQMQCKVYDSMLALSSDLQAARALTVISIVVGIMGILLAMAGGKCTNCIEDEKSKGKVAVVAGIIFIISGVLCLIPVCWTAQTVIRDFYNPLVNQAQKRELAKMVSQGLQILGVLLSMTGWIGTIVTCALPMWRVTAFIGANIVTAQIIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARAMVVISIIVGIFGVLMAVVGGKCTNCMEDESAKAKACIVSGVIFLIAAFLILIPVSWSAQTLIRDFYNPLVIEAQRRELGASLYIGWGSGALLLLGGGLLCWNCPPKENQPYTAAKFAPARSLSPGMNYV"
misc_feature 98..538 /gene="LOC131369125" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:473919" misc_feature 584..1069 /gene="LOC131369125" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:473919" ORIGIN
ttactgggttcgtcagatacctgccaagaaaccacagagctcttttggaacagcacaagaggaagtgaagagacgtctgagcgaaatggtgtcagctgggatgcagatgctgggcgccgccctgggtgtcatcggctggatcggcgttatcgtggtctgtgctctgcccatgtggagggtcacagctttcatcggcaacaacatcgtcacgtcgcagatccagtgggaaggcatatggatgaactgtgtggttcagagcacggggcagatgcagtgcaaggtgtacgactccatgctggcgctgagctcggatctccaagctgcccgcgctctcacggtcatctccatcgtggtgggcatcatgggcatcctgctggccatggctggaggaaaatgcaccaactgcatagaggatgagaagtccaaagggaaggttgctgtggtagcgggcatcatcttcattatttctggggtattgtgcctgatccctgtgtgctggactgcccaaaccgtcatcagggacttctacaacccactggtcaaccaggcgcagaagagagagctggcaaaaatggtatcccaaggcctccagatcttaggtgttttgctgtctatgacagggtggatagggacgatcgtcacttgcgctctgccgatgtggagggtgacagcgttcatcggagcgaacatcgtcacggcgcaaatcatctgggagggtttatggatgaactgtgtggttcagagcacgggacagatgcagtgtaaggtctatgactccctgttggcgcttcctcaggaccttcaggccgcccgagccatggtcgtcatctccatcatagtgggcattttcggtgtgctcatggctgtggtcggaggaaagtgcaccaactgcatggaggacgaatcggcaaaagctaaagcctgcattgtctcgggggtgatcttcctcatcgctgccttcctcatcctcattcctgtcagctggtctgcccagactctcatcagggacttctacaaccccctggtgatagaggctcagcgtcgagagttaggagcttctctgtatattggctggggatctggagctctcctgctgctggggggagggctgctttgctggaattgccccccgaaggaaaaccagccgtatacagcagccaaatttgccccagctagatcattatccccagggatgaattatgtgtaagcaacatggcgcaggtttccatgagaactctgaacaaaagtggactcatatatcgtgtctatgtctatgtctccggaaaggcatgtattttcttttgttttgagatcagatttattttcctattatgtgattgtagaagcactaataataatgatgagatggacatttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]