LOCUS       XM_056675516             261 bp    mRNA    linear   PLN 02-JUN-2023
DEFINITION  Penicillium coprophilum Ankyrin and HET domain protein
            (N7500_004370), partial mRNA.
ACCESSION   XM_056675516
VERSION     XM_056675516.1
DBLINK      BioProject: PRJNA973687
            BioSample: SAMN30185323
KEYWORDS    RefSeq.
SOURCE      Penicillium coprophilum
  ORGANISM  Penicillium coprophilum
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Penicillium.
REFERENCE   1  (bases 1 to 261)
  AUTHORS   Petersen,C., Sorensen,T., Nielsen,M.R., Sondergaard,T.E.,
            Sorensen,J.L., Fitzpatrick,D.A., Frisvad,J.C. and Nielsen,K.L.
  TITLE     Comparative genomic study of the Penicillium genus elucidates a
            diverse pangenome and 15 lateral gene transfer events
  JOURNAL   IMA Fungus 14 (1), 3 (2023)
   PUBMED   36726175
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 261)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (01-JUN-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 261)
  AUTHORS   Petersen,C.
  TITLE     Direct Submission
  JOURNAL   Submitted (01-DEC-2022) Department of Chemistry and Bioscience,
            Aalborg University, Fredrik Bajers Vej 7H, Aalborg, Nordjylland
            9220, Denmark
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_026622722).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..261
                     /organism="Penicillium coprophilum"
                     /mol_type="mRNA"
                     /strain="IBT 35676"
                     /culture_collection="IBT:35676"
                     /db_xref="taxon:36646"
                     /chromosome="Unknown"
     gene            <1..>261
                     /locus_tag="N7500_004370"
                     /db_xref="GeneID:81414688"
     CDS             1..261
                     /locus_tag="N7500_004370"
                     /codon_start=1
                     /product="Ankyrin and HET domain protein"
                     /protein_id="XP_056536041.1"
                     /db_xref="GeneID:81414688"
                     /translation="

MMNEPTNISRPVLFRAREGLPGKGTKNRAGKGDEVWLIAGMPTPVVLRKTEREDCFTRTDIVYVHGIMHGELFDQKDRIQEEIELI"

ORIGIN      

atgatgaatgaaccgacgaatatcagtcgtccagtactctttcgagctcgggaaggtcttccaggcaaaggcaccaagaatcgtgcaggaaaaggcgatgaggtgtggctcattgctggaatgccgaccccagttgtgttgcgaaagacagagcgtgaggattgtttcacaagaactgatattgtctatgttcacgggatcatgcatggagaattgtttgaccagaaagatcgtatacaagaagagattgagctcatctag

//