LOCUS       XM_046846099             975 bp    mRNA    linear   VRT 18-FEB-2022
DEFINITION  PREDICTED: Silurus meridionalis vimentin (vim), partial mRNA.
ACCESSION   XM_046846099
VERSION     XM_046846099.1
DBLINK      BioProject: PRJNA807317
KEYWORDS    RefSeq.
SOURCE      Silurus meridionalis (Silurus soldatovi meridionalis)
  ORGANISM  Silurus meridionalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Siluridae; Silurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060887) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Silurus meridionalis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..975
                     /organism="Silurus meridionalis"
                     /mol_type="mRNA"
                     /isolate="SWU-2019-XX"
                     /db_xref="taxon:175797"
                     /chromosome="4"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            <1..975
                     /gene="vim"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 20 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 15 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:124383795"
     CDS             <1..603
                     /gene="vim"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_046702055.1"
                     /db_xref="GeneID:124383795"
                     /translation="

FFALRDVRLQYESLANKNIHEAEEWYKSKFADLSEAAARNMEAIRHTKQDANEYRRQVQALTCEVDSLKGTNESLERQMAELEDTFAMESSNYQDTITHLEEEIRNMKDEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRITTPLPNFSTFNLRESMIETKPLIENLSKKVLIKTIETRDGHVINESTQPHEDLE"

     misc_feature    <7..435
                     /gene="vim"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
     polyA_site      975
                     /gene="vim"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

ttctttgcactgcgggatgtccgccttcaatatgagagtctggccaacaagaacatccatgaggctgaggaatggtacaaatccaagtttgcagatttgtctgaggctgctgctcgtaacatggaggccatccgtcatactaagcaggatgcaaatgaatatcgccgccaggtccaggctttaacatgtgaggtggattcgcttaaaggcactaatgagtctctagagcgtcaaatggcggaactggaggacacctttgccatggagtcatctaattaccaggacaccatcacccatctggaagaagaaatccgcaacatgaaggatgagatggctcgtcacttgcgtgagtaccaggacttgctgaatgtcaaaatggccctggacattgagattgctacctacaggaagcttctggagggagaggagagcaggatcaccacaccattacctaatttttctacatttaatctgagagaatccatgatagaaaccaaaccactcattgagaacctgtccaagaaagtgttgattaaaaccatagagacaagagatggtcatgtgattaacgagtccactcagcctcatgaagacctggaatgaactgcatgcaaaacctttaaaagaaatgctcactgagaaggcgagcgctgtagcgggaggagatatatcagtgtgatatttctgtttctgtgacactaaatcagctttaatgtgcctttttgccactcgagacagatcttcagatagagatgtgtcttaagtagaatagggtttgtaggccagtgaaaaccagctctatacagtatttctgttttcctaaactactatagtttacactctgcaagttggaccacagcaataatcttagcaacattgattttttttgttttcggtcagcttgcagcttgaccaacatgaaatgatgtcttcaaaatcaaacaaacaaataaaatcaacacacctttatgaaaa

//