2024-04-20 18:10:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_046405676 1261 bp mRNA linear VRT 03-FEB-2022 DEFINITION PREDICTED: Scatophagus argus vimentin-related 2 (vimr2), transcript variant X4, mRNA. ACCESSION XM_046405676 VERSION XM_046405676.1 DBLINK BioProject: PRJNA776026 KEYWORDS RefSeq. SOURCE Scatophagus argus ORGANISM Scatophagus argus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Scatophagidae; Scatophagus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_058504.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Scatophagus argus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1261 /organism="Scatophagus argus" /mol_type="mRNA" /isolate="fScaArg1" /db_xref="taxon:75038" /chromosome="12" /tissue_type="muscle" /dev_stage="adult" /country="Singapore" /lat_lon="1.3521 N 103.8198 E" /collection_date="2018-08-06" /collected_by="Byrappa Venkatesh" gene 1..1261 /gene="vimr2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:124067903" CDS 122..1129 /gene="vimr2" /codon_start=1 /product="keratin, type II cytoskeletal 74 isoform X4" /protein_id="XP_046261632.1" /db_xref="GeneID:124067903" /translation="
MAMLRVSSYRKLFEEDDWRSGGLNVQCAGQYGSSIRGAAINECDCDKLDFAATKTINQDGLNQFVQDRTIIAALNDRLIRLIEVARCFEEENESLECQIVELEEKLNSRRASSRVTSSVAEPDCSLDAVVERLRREKNEILCDTEELQKELERLMKEYEKAAQQRITLQEEQQDVAEEVDAVTAWCLALREQVAIYEEQLANMEAQHKTALESLLEPAEGTTGAVAAIKFGSPDITPALDVKEYYCQLAESLQYECGAASSVVVRSADDKQLEVGGALGSTVKDLPKIKDVNEMKMLISQLQKELAELEKWNKELEDDVEMKKAAHMDEIAELEV"
misc_feature 317..1114 /gene="vimr2" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:425436" ORIGIN
gtgagagatccttcacgtcagtgctacattctcgttctctgtgaatataaaaccccccaccttggattctccttgccattttcctgttgggttgtaatctagtttggaaccatccaatgccatggccatgctccgggtttcctcttaccgcaagctgtttgaggaggatgactggagaagtggcgggttgaatgtgcagtgtgcagggcagtacgggtcctccatcaggggtgcggccatcaacgagtgtgactgtgacaagttagactttgcagctaccaagaccatcaaccaggatggtctgaaccagtttgtccaggaccgcaccatcatcgctgccctcaatgaccgcttgatcaggctcattgaagtggcccgttgttttgaggaggaaaacgagtctcttgaatgtcagattgttgaactagaggagaaactgaacagtcgacgagcctcctctcgtgtcacctcttctgtggctgagcctgactgtagtctggatgcagttgtggaaagactgcggagggagaagaatgagattctctgtgacacagaggaactgcagaaagagcttgaacgtctcatgaaagagtatgagaaggctgcacagcagaggatcaccctccaggaggagcaacaagatgtcgctgaggaagtggatgctgtgacagcatggtgtttggcgttgagggaacaagtggctatctatgaggagcagctggccaacatggaggcccagcacaaaacggcactggagagtctgctggagccagccgaagggactacaggagcggtggcagctattaaatttggcagccctgacatcactccggccttggatgtaaaggagtactactgccagctggctgagagcctccagtacgagtgtggtgcagcctcttctgtggtggttcgcagcgctgatgataaacaactggaagtgggaggagctctagggtcaacagtcaaagacttgccgaagataaaggatgtcaatgagatgaagatgcttatttcacagctacaaaaggagctcgctgagctcgagaagtggaacaaggagctggaggacgacgttgagatgaagaaggctgcacacatggacgagatcgctgagttggaggtctgaggggggtgtactatagatgaaatgcgacaccaggaggccaactttaaagagcagatgaaggagcagtgtgaagactacaaggggctgctcagtgagaagatggccagagacatggaaatagctgcctacagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]