GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 18:10:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_046405676            1261 bp    mRNA    linear   VRT 03-FEB-2022
DEFINITION  PREDICTED: Scatophagus argus vimentin-related 2 (vimr2), transcript
            variant X4, mRNA.
ACCESSION   XM_046405676
VERSION     XM_046405676.1
DBLINK      BioProject: PRJNA776026
KEYWORDS    RefSeq.
SOURCE      Scatophagus argus
  ORGANISM  Scatophagus argus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Scatophagidae; Scatophagus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_058504.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Scatophagus argus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1261
                     /organism="Scatophagus argus"
                     /mol_type="mRNA"
                     /isolate="fScaArg1"
                     /db_xref="taxon:75038"
                     /chromosome="12"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Singapore"
                     /lat_lon="1.3521 N 103.8198 E"
                     /collection_date="2018-08-06"
                     /collected_by="Byrappa Venkatesh"
     gene            1..1261
                     /gene="vimr2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 5 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:124067903"
     CDS             122..1129
                     /gene="vimr2"
                     /codon_start=1
                     /product="keratin, type II cytoskeletal 74 isoform X4"
                     /protein_id="XP_046261632.1"
                     /db_xref="GeneID:124067903"
                     /translation="
MAMLRVSSYRKLFEEDDWRSGGLNVQCAGQYGSSIRGAAINECDCDKLDFAATKTINQDGLNQFVQDRTIIAALNDRLIRLIEVARCFEEENESLECQIVELEEKLNSRRASSRVTSSVAEPDCSLDAVVERLRREKNEILCDTEELQKELERLMKEYEKAAQQRITLQEEQQDVAEEVDAVTAWCLALREQVAIYEEQLANMEAQHKTALESLLEPAEGTTGAVAAIKFGSPDITPALDVKEYYCQLAESLQYECGAASSVVVRSADDKQLEVGGALGSTVKDLPKIKDVNEMKMLISQLQKELAELEKWNKELEDDVEMKKAAHMDEIAELEV"
     misc_feature    317..1114
                     /gene="vimr2"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
ORIGIN      
gtgagagatccttcacgtcagtgctacattctcgttctctgtgaatataaaaccccccaccttggattctccttgccattttcctgttgggttgtaatctagtttggaaccatccaatgccatggccatgctccgggtttcctcttaccgcaagctgtttgaggaggatgactggagaagtggcgggttgaatgtgcagtgtgcagggcagtacgggtcctccatcaggggtgcggccatcaacgagtgtgactgtgacaagttagactttgcagctaccaagaccatcaaccaggatggtctgaaccagtttgtccaggaccgcaccatcatcgctgccctcaatgaccgcttgatcaggctcattgaagtggcccgttgttttgaggaggaaaacgagtctcttgaatgtcagattgttgaactagaggagaaactgaacagtcgacgagcctcctctcgtgtcacctcttctgtggctgagcctgactgtagtctggatgcagttgtggaaagactgcggagggagaagaatgagattctctgtgacacagaggaactgcagaaagagcttgaacgtctcatgaaagagtatgagaaggctgcacagcagaggatcaccctccaggaggagcaacaagatgtcgctgaggaagtggatgctgtgacagcatggtgtttggcgttgagggaacaagtggctatctatgaggagcagctggccaacatggaggcccagcacaaaacggcactggagagtctgctggagccagccgaagggactacaggagcggtggcagctattaaatttggcagccctgacatcactccggccttggatgtaaaggagtactactgccagctggctgagagcctccagtacgagtgtggtgcagcctcttctgtggtggttcgcagcgctgatgataaacaactggaagtgggaggagctctagggtcaacagtcaaagacttgccgaagataaaggatgtcaatgagatgaagatgcttatttcacagctacaaaaggagctcgctgagctcgagaagtggaacaaggagctggaggacgacgttgagatgaagaaggctgcacacatggacgagatcgctgagttggaggtctgaggggggtgtactatagatgaaatgcgacaccaggaggccaactttaaagagcagatgaaggagcagtgtgaagactacaaggggctgctcagtgagaagatggccagagacatggaaatagctgcctacagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]