LOCUS       XM_044932834            2444 bp    mRNA    linear   MAM 17-NOV-2021
DEFINITION  PREDICTED: Bubalus bubalis dicer 1, ribonuclease III (DICER1),
            transcript variant X5, mRNA.
ACCESSION   XM_044932834
VERSION     XM_044932834.1
DBLINK      BioProject: PRJNA779724
KEYWORDS    RefSeq.
SOURCE      Bubalus bubalis (water buffalo)
  ORGANISM  Bubalus bubalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Bovidae; Bovinae; Bubalus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_059176.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bubalus bubalis Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2444
                     /organism="Bubalus bubalis"
                     /mol_type="mRNA"
                     /isolate="160015118507"
                     /db_xref="taxon:89462"
                     /chromosome="20"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="Adult Heifer"
                     /geo_loc_name="India: Hissar, Haryana"
                     /breed="Murrah"
     gene            1..2444
                     /gene="DICER1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 mRNAs, 8 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 75 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102412807"
     CDS             344..2353
                     /gene="DICER1"
                     /codon_start=1
                     /product="endoribonuclease Dicer isoform X3"
                     /protein_id="XP_044788769.1"
                     /db_xref="GeneID:102412807"
                     /translation="

MKSPALQPLSMAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLTKELSYQIRGDFNRNGKRTVFLVNSANQVAQQVSAVRTHSDLKVGEYSNLEVSASWTKEKWNLEFTKHQVLVMTCYVALNVLKNGYLSLSDINLLVFDECHLAILDHPYREIMKLCENCPSCPRILGLTASILNGKCDPEELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPFTDRSGLYERLLMELEEALNFINDCNISVHSKERDSTLISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKHIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDEEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEAEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYVMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDTGEADTEPVVDDDDVFPPYVLRPEDGPRVTINTAIGHVNRYCARLPSDPFTHLAPKCRTRELPDGSPNELHSIG"

     misc_feature    467..1060
                     /gene="DICER1"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(467..478,485..487,536..559,680..682,869..871,
                     962..964)
                     /gene="DICER1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350792"
     misc_feature    order(644..649,716..721,794..796,800..805,812..814,
                     887..895)
                     /gene="DICER1"
                     /note="nucleic acid binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:350792"
     misc_feature    1154..1438
                     /gene="DICER1"
                     /note="Partner-binding domain of the endoribonuclease
                     Dicer; Region: Dicer_PBD; cd15903"
                     /db_xref="CDD:277191"
     misc_feature    order(1169..1174,1181..1183,1187..1192,1367..1372,
                     1379..1384,1391..1393,1400..1405,1412..1414)
                     /gene="DICER1"
                     /note="Trbp binding interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:277191"
     misc_feature    1457..2035
                     /gene="DICER1"
                     /note="C-terminal helicase domain of the endoribonuclease
                     Dicer; Region: SF2_C_dicer; cd18802"
                     /db_xref="CDD:350189"
     misc_feature    order(1688..1696,1904..1906,1961..1963,1967..1969)
                     /gene="DICER1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:350189"
     misc_feature    order(1916..1918,1922..1924,1997..1999,2003..2005)
                     /gene="DICER1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350189"
     misc_feature    2228..>2323
                     /gene="DICER1"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:460900"
     polyA_site      2444
                     /gene="DICER1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

aggcgacggcgagcgggaggacatggcggcggcggcggcggcgccgggcggcaccgggaggcctgggctgtgacgcgcgcgccggagcgggggtccgatggttctcgaaggcccgcggcgccccgtgctgcaggttacctagggtatgaattaatacagacttggaaactgaaagaacttagaatcagcattttgagagcagaagcttgggtatgctgtgattttccaataaactgctatcacaatgtcaaaatgcagttcagacaacagcaacacagagatctcaaacattaagacgtaagctgtgctagaacaaaaatgcaatgaaagagacactggatgaatgaaaagccctgctttgcaacccctcagcatggcaggcctgcagctcatgacccctgcttcctcaccaatgggtcctttctttggacttccatggcaacaagaagcaattcatgataacatttatacgccaagaaaatatcaggttgaactgcttgaagcagctctggatcataataccatagtctgtttaaacactggctcagggaagacgtttattgcagtactactcactaaagagctgtcctatcagatcaggggagacttcaacagaaatggcaaaaggacggtgttcttggtcaactctgcaaaccaggttgctcaacaagtgtcagctgtcagaactcactcagatctcaaggtcggggaatactcaaacttagaagtaagtgcatcttggacaaaagagaaatggaacctagagtttactaaacatcaggttctcgttatgacttgctatgtcgccttgaatgttttgaaaaatggttacttatcactgtcagacattaaccttttggtgtttgatgagtgtcatcttgcaatcctagaccacccctaccgagaaattatgaagctttgtgaaaattgtccatcatgtcctcgtattttgggactaactgcttccattttaaatgggaaatgtgatccagaggaattggaagaaaagattcagaaactggagaaaattcttaagagtaatgctgaaactgcaactgacttggtggtcttagacagatatacttctcagccatgtgagattgtggtagactgtggaccatttactgacagaagtgggctttatgaaagactgctgatggagttagaagaagcacttaattttatcaatgactgtaacatatctgtacattcaaaagaaagagattctactttaatttctaaacagatactctcagactgccgtgcggtcctggttgtcctgggaccctggtgtgccgataaagtagctggaatgatggtcagagagctgcagaaacacatcaaacatgagcaagaggagctgcaccggaagtttctgttgttcacagacactttcctacggaaaatccacgccctgtgtgaagagcacttctcccctgcctcgcttgacctgaagtttgtcactcctaaagtaataaagctgctcgagatcttacgcaaatacaaaccgtatgagcggcagcagtttgaaagcgtggagtggtataataataggaaccaggataattacgtgtcctggagcgattctgaggatgacgaggaagatgaagagattgaagagaaagaaaagccagagacaaattttccttctccatttaccaatattttgtgtggaattatttttgtggaaagaagatacacagccgtggtcttaaacagattgataaaggaagctggcaaacaagatccagagctggcttacatcagcagcaattttataactggacatggcatcggaaagaatcagcctcggaacaaacagatggaagcagaattcagaaagcaggaagaggtacttaggaaatttcgagcacatgaaaccaacctgcttattgcaacaagtattgtggaggagggtgtcgacataccgaaatgcaacttggtggttcgtttcgatctgcccacagagtatcgatcctacgttcagtcgaagggaagagcgagggcacccatctctaattatgtaatgttagcagacacagataaaataaagagttttgaagaagaccttaaaacatacaaagctattgaaaagatcttgcgaaacaaatgttccaagtcggttgataccggggaggccgacacggagcccgtggtggatgacgacgatgttttcccaccgtacgtgctgaggcctgaggacggtccccgtgtcacgatcaacacagccattgggcatgtcaacagatactgtgctagattaccaagtgatccatttactcatctggctcctaaatgtagaacccgagagttgcctgatgggtcccccaatgagctgcattcgattggctgaaagagtcgtggctctcatttgctgtgaaaaactgcacaaaattggcgaactggatgaccatttgatgccagttgggaaggagactgttaaa

//