LOCUS       XM_044918342            2538 bp    mRNA    linear   MAM 03-NOV-2021
DEFINITION  PREDICTED: Neomonachus schauinslandi dicer 1, ribonuclease III
            (DICER1), transcript variant X6, mRNA.
ACCESSION   XM_044918342
VERSION     XM_044918342.1
DBLINK      BioProject: PRJNA392091
KEYWORDS    RefSeq.
SOURCE      Neomonachus schauinslandi (Hawaiian monk seal)
  ORGANISM  Neomonachus schauinslandi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Pinnipedia; Phocidae; Monachinae; Monachini; Neomonachus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_058411.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Neomonachus schauinslandi Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2538
                     /organism="Neomonachus schauinslandi"
                     /mol_type="mRNA"
                     /db_xref="taxon:29088"
                     /chromosome="9"
                     /sex="male"
                     /tissue_type="blood"
                     /geo_loc_name="USA: Kuai'i, HI"
                     /collection_date="2015-01-12"
                     /collected_by="NOAA"
     gene            1..2538
                     /gene="DICER1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 3 ESTs, 1 Protein, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:110571666"
     CDS             172..2460
                     /gene="DICER1"
                     /codon_start=1
                     /product="endoribonuclease Dicer isoform X5"
                     /protein_id="XP_044774277.1"
                     /db_xref="GeneID:110571666"
                     /translation="

MKSPALQPLSMAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLTKELSYQIRGDFSRNGKRTVFLVNSANQVAQQVSAVRTHSDLKVGEYSDLEVNASWTKEKWNQEFTKHQVLVMTCYVALNVLKNGYLSLSDINLLVFDECHLAILDHPYREIMKLCENCPSCPRILGLTASILNGKCDPEELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPFTDRSGLYGRLLVELEDALHFINDCNVSVHSKERDSTLISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEAEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYIMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDTGETDIEPVVDDDDVFPPYVLRPDDGGPRVTINTAIGHINRYCARLPSDPFTHLAPKCRTRELPDGTFYSTLYLPINSPLRASIVGPPMSCIRLAERVVALICCEKLHKIGELDDHLMPVGKETVKYEEELDLHDEEETSVPGRPGSTKRRQCYPKAVSIDSRMFEG"

     misc_feature    295..888
                     /gene="DICER1"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(295..306,313..315,364..387,508..510,697..699,
                     790..792)
                     /gene="DICER1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350792"
     misc_feature    order(472..477,544..549,622..624,628..633,640..642,
                     715..723)
                     /gene="DICER1"
                     /note="nucleic acid binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:350792"
     misc_feature    988..1266
                     /gene="DICER1"
                     /note="Partner-binding domain of the endoribonuclease
                     Dicer; Region: Dicer_PBD; cd15903"
                     /db_xref="CDD:277191"
     misc_feature    order(997..1002,1009..1011,1015..1020,1195..1200,
                     1207..1212,1219..1221,1228..1233,1240..1242)
                     /gene="DICER1"
                     /note="Trbp binding interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:277191"
     misc_feature    1285..1863
                     /gene="DICER1"
                     /note="C-terminal helicase domain of the endoribonuclease
                     Dicer; Region: SF2_C_dicer; cd18802"
                     /db_xref="CDD:350189"
     misc_feature    order(1516..1524,1732..1734,1789..1791,1795..1797)
                     /gene="DICER1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:350189"
     misc_feature    order(1744..1746,1750..1752,1825..1827,1831..1833)
                     /gene="DICER1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350189"
     misc_feature    2059..2325
                     /gene="DICER1"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:460900"
ORIGIN      

aaagaacttagaatcagcattttgagagcagaagcttaagcatgctgtgatttcccaataaactgctatcacaatgtcaaaatgcagttcagacaacagcaacacagagatctcaaacattaaaacgtaagctgtgctagagcaaaatgcaatgaaagaagcactggatgaatgaaaagccctgctttgcagcccctcagcatggcaggcctgcagctcatgacccctgcctcctcaccaatgggtcctttctttggactgccatggcaacaagaagcaattcatgataacatttatacgccaagaaaatatcaggttgaactgcttgaagcagctctggatcataataccatagtctgtttaaacactggctcagggaagacgtttattgcagtactactcactaaagagctgtcctatcagatcaggggagacttcagcagaaatggaaaaaggacggtgttcttggtcaactctgcaaaccaggttgctcaacaagtgtcagctgtcagaactcattcagatctcaaggttggggaatactcagacctagaagtaaatgcatcttggacaaaagagaaatggaaccaagagtttactaagcaccaggttctcgttatgacttgctatgtcgccttgaatgttttgaaaaatggttacttatcactgtcagacattaaccttttggtctttgatgagtgtcatcttgcaatcctagaccacccctaccgagaaattatgaagctctgtgaaaattgtccatcgtgtcctcgcattttgggactcactgcttccattttaaatgggaaatgtgatcctgaggaattggaagaaaagatccagaaactggagaaaattctgaagagtaatgctgaaactgcaaccgacctggtggtcttggacagatacacttctcaaccgtgtgagattgtggtagactgtgggccattcacggacagaagtgggctctatggcagactgctggtggagctagaggacgcacttcactttatcaacgactgtaatgtatctgtgcattcgaaagaaagagattctactttaatttctaaacagatcctgtcagactgtcgtgcggtattggtggttctgggcccctggtgtgcagataaggtagctggaatgatggtaagagaactgcagaaatacatcaaacatgaacaagaggagctgcacaggaaatttctattgtttacagacaccttcctgaggaaaatacatgcactatgtgaagagcacttctctcctgcctcacttgacctgaaatttgtaactcctaaagtaataaaactgcttgaaattttacgcaaatataagccgtatgagcggcagcagtttgaaagtgttgagtggtataataataggaatcaggataattatgtgtcttggagtgattctgaggatgatgatgaggatgaagaaattgaagaaaaagagaagccggagacaaattttccttctccatttaccaatattttatgtggaatcatttttgtggaaagaagatacacggccgttgtcttaaacagattgataaaggaagctggcaaacaagatccagagctggcttacatcagcagcaattttataactggacatggcattggaaagaatcagcctcgtaacaaacagatggaagcagaattcagaaaacaggaagaggtccttaggaaatttcgagcacatgagaccaatctcctcattgcaacaagtattgtggaagaaggtgttgatataccaaaatgcaacttggtggttcgatttgatttgcccacagagtatcgatcctatgttcaatctaagggaagagcaagggcaccgatctctaattatataatgttagcagatacagacaaaataaaaagttttgaagaagaccttaaaacctacaaagctattgaaaagatcttgagaaacaagtgttccaagtcagttgacactggtgagactgacattgaacctgttgtggatgatgacgatgtgttcccaccatatgtgttgaggcccgatgatggtggtccacgagtcacaatcaacacggccattggacacatcaatagatactgtgctagattaccaagcgatccgtttactcatctagctcctaaatgtagaacccgagagttgcctgatggtacattttattcaactctttatctgccaattaactcacctctccgagcctccattgttggtccaccaatgagctgtatccgattggccgaaagagttgtagctctcatttgctgtgaaaaactgcacaaaattggtgaactggatgaccatttgatgccagttgggaaagagactgttaaatatgaagaggagcttgatttacatgatgaagaggagaccagtgttcctggaagaccaggttccacaaaacgaagacagtgctacccaaaagcagttagtattgattccagaatgtttgagggatagctatcccaaacccgatcagccctgttacctgtatgtgataggaatggttctgacaacacccttacccgatgaactcaa

//