LOCUS       XM_044018916             732 bp    mRNA    linear   VRT 03-OCT-2021
DEFINITION  PREDICTED: Solea senegalensis NADH-ubiquinone oxidoreductase chain
            5-like (LOC122764914), mRNA.
ACCESSION   XM_044018916
VERSION     XM_044018916.1
DBLINK      BioProject: PRJNA767562
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Solea senegalensis (Senegalese sole)
  ORGANISM  Solea senegalensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei;
            Soleidae; Solea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_025322517.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Solea senegalensis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 55% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..732
                     /organism="Solea senegalensis"
                     /mol_type="mRNA"
                     /isolate="Sse05_10M"
                     /db_xref="taxon:28829"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="Breeder"
     gene            1..732
                     /gene="LOC122764914"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 44% coverage of the annotated
                     genomic feature by RNAseq alignments, including 8 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:122764914"
     CDS             1..732
                     /gene="LOC122764914"
                     /codon_start=1
                     /product="NADH-ubiquinone oxidoreductase chain 5-like"
                     /protein_id="XP_043874851.1"
                     /db_xref="GeneID:122764914"
                     /translation="

MVITFFMFFMVIMVLMFFMFFMFFMVFMILTVFMVIMFFKVFMVIMVIMFFMILMVFMVIMFFMILMVFMVIMVIMVFMVIMVIMFFMFFMVIMVFMVIMFFMILMVFMVIMFFMVFMVIMVFMFFMVFMVIMFLMVFMFFMILMVFMVIMVFMILMVFMVIMFFMVIMVFMFFMVFMVIMFLMVFMFFMVFMFFMFFMVFMVIMFFMVIMFFMVIMFFMVFMVIMVIMVFMVFILLLMNNLC"

ORIGIN      

atggtcatcacattcttcatgttcttcatggtcatcatggtcctcatgttcttcatgttcttcatgttcttcatggtcttcatgatcctcacggtattcatggttatcatgttcttcaaggtattcatggtcatcatggtcatcatgttcttcatgatcctcatggtcttcatggtcatcatgttcttcatgatcctcatggtcttcatggttatcatggttatcatggtcttcatggtcatcatggtcatcatgttcttcatgttcttcatggtcatcatggtcttcatggtcatcatgttcttcatgatcctcatggtcttcatggttatcatgttcttcatggtattcatggtcatcatggtctttatgttcttcatggtcttcatggtcatcatgttcttgatggtcttcatgttcttcatgatcctcatggtcttcatggttatcatggtcttcatgatcctcatggtcttcatggttatcatgttcttcatggtcatcatggtctttatgttcttcatggtcttcatggtcatcatgttcttgatggtcttcatgttcttcatggtcttcatgttcttcatgttcttcatggtattcatggtcatcatgttcttcatggtcatcatgttcttcatggtcatcatgttcttcatggtcttcatggtcatcatggtcatcatggtcttcatggtcttcatcctcctgctgatgaataatctctgctga

//