GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-06 01:31:34, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_041145686             696 bp    mRNA    linear   PLN 03-MAY-2021
DEFINITION  PREDICTED: Juglans microcarpa x Juglans regia uncharacterized
            LOC121247318 (LOC121247318), mRNA.
ACCESSION   XM_041145686
VERSION     XM_041145686.1
DBLINK      BioProject: PRJNA726248
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Juglans microcarpa x Juglans regia
  ORGANISM  Juglans microcarpa x Juglans regia
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fagales; Juglandaceae; Juglans.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_054595.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Juglans microcarpa x Juglans regia
                                           Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..696
                     /organism="Juglans microcarpa x Juglans regia"
                     /mol_type="mRNA"
                     /isolate="MS1-56"
                     /db_xref="taxon:2249226"
                     /chromosome="1S"
                     /tissue_type="young leaves"
                     /dev_stage="seedling"
                     /geo_loc_name="USA: UC Davis"
                     /note="This is the F1 progeny of a cross between Juglans
                     microcarpa isolate 31.01 and Juglans regia cultivar Serr"
     gene            1..696
                     /gene="LOC121247318"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:121247318"
     CDS             1..696
                     /gene="LOC121247318"
                     /codon_start=1
                     /product="uncharacterized protein LOC121247318"
                     /protein_id="XP_041001620.1"
                     /db_xref="GeneID:121247318"
                     /translation="
MTIDRQVVAPTPEDVIETDEAKKNQSGKQVSQPEMTIDRQVVAPTPEDVIETDEAKKNQSGKQVSQPEMTIDRQVVAPTPEDVIETDEAKKNQRKLNVKKKAFLTEQVSALVLSETPQKLGDPGSPNISIIIGESGIERALLDLGSSVNLLPFSVNEELGLGELKKTSIMLQLVDRSVKVPRGIVEDVLVQATSTIYQALVILGSPFLAMSNALINCRSGVLTLTSGKHGT"
     misc_feature    415..627
                     /gene="LOC121247318"
                     /note="Cellular and retroviral pepsin-like aspartate
                     proteases; Region: pepsin_retropepsin_like; cl11403"
                     /db_xref="CDD:472175"
     misc_feature    order(427..429,433..435,439..441,511..519,604..606)
                     /gene="LOC121247318"
                     /note="inhibitor binding site [active]"
                     /db_xref="CDD:133137"
     misc_feature    427..435
                     /gene="LOC121247318"
                     /note="catalytic motif [active]"
                     /db_xref="CDD:133137"
     misc_feature    427..429
                     /gene="LOC121247318"
                     /note="Catalytic residue [active]"
                     /db_xref="CDD:133137"
     misc_feature    order(511..522,532..543)
                     /gene="LOC121247318"
                     /note="Active site flap [active]"
                     /db_xref="CDD:133137"
ORIGIN      
atgaccattgacagacaagtagttgctcctacacctgaagatgtaatagagactgatgaagccaaaaagaaccagagtggaaagcaagtttcccaaccagagatgaccattgacagacaagtagttgctcctacacctgaagatgtaatagagactgatgaagccaaaaagaaccagagtggaaagcaagtttcccaaccagagatgaccattgacagacaagtagttgctcctacacctgaagatgtaatagagactgatgaagccaaaaagaaccagaggaagctaaatgtaaagaagaaagctttcctaacagagcaagtcagtgcattggtattgagcgagactcctcagaagttaggagatcccggctctccgaacatttccattattatcggtgagtcaggcattgagagagctttacttgatttggggagtagtgtgaacttgctaccgttctcagtgaatgaggagttgggattaggtgagctaaaaaagacctctatcatgctacagttggttgacagatcagttaaagtgccaaggggtattgttgaggatgtgttggtccaggctacctccactatttaccaagctcttgtcattcttggaagcccatttctagctatgtcaaatgctttgattaattgcagaagtggagttttgacacttacttctgggaaacatggcacttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]