2024-03-29 15:54:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_040941760 3171 bp mRNA linear PLN 20-APR-2021 DEFINITION Aspergillus fijiensis CBS 313.89 putative RNA interference and gene silencing protein (BO72DRAFT_389317), partial mRNA. ACCESSION XM_040941760 VERSION XM_040941760.1 DBLINK BioProject: PRJNA722001 BioSample: SAMN05660285 KEYWORDS RefSeq. SOURCE Aspergillus fijiensis CBS 313.89 ORGANISM Aspergillus fijiensis CBS 313.89 Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Aspergillus. REFERENCE 1 (bases 1 to 3171) AUTHORS Vesth,T.C., Nybo,J., Theobald,S., Brandl,J., Frisvad,J.C., Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Kuo,A., Riley,R., Clum,A., Nolan,M., Lipzen,A., Salamov,A., Henrissat,B., Wiebenga,A., De vries,R.P., Grigoriev,I.V., Mortensen,U.H., Andersen,M.R. and Baker,S.E. CONSRTM DOE Joint Genome Institute TITLE The genomes of Aspergillus section Nigri reveals drivers in fungal speciation JOURNAL Unpublished REFERENCE 2 (bases 1 to 3171) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (15-APR-2021) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 3171) AUTHORS Mondo,S., Kuo,A., Riley,R., Clum,A., Nolan,M., Lipzen,A., Salamov,A., Vesth,T.C., Nybo,J., Theobald,S., Brandl,J., Frisvad,J.C., Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Henrissat,B., Wiebenga,A., De vries,R.P., Mortensen,U.H., Andersen,M.R., Baker,S.E., Grigoriev,I.V., Nordberg,H.P., Cantor,M.N. and Hua,S.X. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (12-FEB-2018) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_024469050). ##Metadata-START## Organism Display Name :: Aspergillus fijiensis CBS 313.89 GOLD Stamp ID :: Gp0047234 ##Metadata-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..3171 /organism="Aspergillus fijiensis CBS 313.89" /mol_type="mRNA" /strain="CBS 313.89" /culture_collection="CBS:313.89" /type_material="culture from holotype of Aspergillus fijiensis" /db_xref="taxon:1448319" /chromosome="Unknown" gene <1..>3171 /locus_tag="BO72DRAFT_389317" /db_xref="GeneID:63859093" CDS 1..3171 /locus_tag="BO72DRAFT_389317" /codon_start=1 /product="putative RNA interference and gene silencing protein" /protein_id="XP_040796568.1" /db_xref="GeneID:63859093" /db_xref="InterPro:IPR003100" /db_xref="InterPro:IPR003165" /db_xref="InterPro:IPR014811" /db_xref="JGIDB:Aspfij1_389317" /translation="
MSDSRGWQRGRGRGGDRARGDRGRGGGGDRGRGGYRGGGGGGGGGGRGGGSGRGSFDLPFRPGDDGRGDGRGDGRGRGRPRGSDAFRGGRPPRGGKADYNGPEVFSPGGNLKPSSQVEEKEDAMMNALVKAPPSPKDSKYPRRPGYGTKGTRVDLFANYLQLKSIGKTLHRHRVEILEDQSVRRPTGKKAKQVIKLLIEEHFASQRNGVVTDFVSTLISRDKLLEEGENEHTYDVRYRDEYDDEYPEPSKVYRVKCQHTGTLEPSDLLDYLTSANATNMFDRKPEILQAMNIVLGHQPKIDPNIYSVGANRHFAIAQGQKEGYNLGDGLEALRGFFVSVRAATSRLLVNVQVKYAACYQEGALADLITSYQPNRFEFHSLQRFLKNLRIRATHIERKNKQGVIIPRFKRIASLANTGDGASLPHPPTVPRLGAGPNDVKFWLDEAGQQSSQQQSASSKKKGKKPATAGPPPAGRYISVAEFFNERYNMTNLDPRMPVMNVGTRENPSYLPVEVCNVEPGQQAKTKLSPYQTREMLKFAVNVPPVNAQSIVNNGTRILGLSAASNATLKEFGIQADPRLITVPGRILEAPQIFYKDANNKEKRLSSSGGSWNMRSIKFSIGSSLGSWAWLFLDSSPTRAPTREVLGAALEHFVTKLREVGVQANPPQGGERVVLARGDVDDQIGGAVKRLMAAHKPTMILGILTDQSTEVYNCMKRVCDVREGVRNVNVLVKNFTTDKGREQYLANVGLKVNLKLGGANQLIPRELGIVSKGKTMLVGIDVTHPSPGSSSKAPSVAGMVASIDSYLGQWPAELRIQTSRQERVSELDTMLKAHLGRWAKTNKGQYPDNIIVYRDGVSEGQYEMVVEEELPLLKSACKQLYPATEHAKGLPRISVVIVGKRHHTRFYPTRKEDADGHLNPKNGTVVDRGVTEARNWEFYLQAHTALKGTARPAHYFTVWDEIFCREKPKEGQNTADILEDLTHKMCYLFGRATKAVSICPPAYYADLVCERARCYLSDLYDATPTGSVVTGGGGGGAHAVDGGRVTIHPNVKDTMFYI"
misc_feature 601..882 /locus_tag="BO72DRAFT_389317" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 922..1077 /locus_tag="BO72DRAFT_389317" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 1117..1548 /locus_tag="BO72DRAFT_389317" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1222..1224,1318..1320,1432..1434,1444..1446, 1498..1500,1519..1521,1525..1527) /locus_tag="BO72DRAFT_389317" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1696..3042 /locus_tag="BO72DRAFT_389317" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(2128..2130,2140..2142,2176..2187,2194..2196, 2224..2226,2233..2235,2245..2247,2257..2259) /locus_tag="BO72DRAFT_389317" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2335..2337,2341..2343,2557..2559,3010..3012) /locus_tag="BO72DRAFT_389317" /note="active site" /db_xref="CDD:240015" ORIGIN
atgtctgattctcgaggttggcaacgaggccgtggtcgcggcggtgaccgtgccagaggtgaccgtggtcggggaggaggcggtgaccgcggtcgtggaggttatcgtggcggcggcggcggcggaggtggtggtggtcgtggaggtggaagcggccgtggctctttcgatcttcccttccgtcctggagacgatgggaggggcgatggcaggggcgatggcaggggtcgtggtcgtcccagaggttccgatgcatttcgtggcggtcgcccgccacgcggcggaaaagctgactacaacggcccggaggtcttctcccccggcggaaacctcaaacccagctcccaggtcgaagagaaggaggatgcgatgatgaacgcattggtcaaggcaccgccctcgcccaaagacagcaaatacccccgccgtcccggctacggtacgaagggaacgagagtcgacttattcgccaactatcttcagctcaagtcgatcggcaaaaccctccaccgccatcgcgtcgaaattctcgaagaccagtccgtcaggaggcctaccggcaagaaggcgaagcaagtcatcaaactgttgattgaggagcattttgcttcgcagcgaaatggcgttgtcaccgacttcgtctccactctcatctcccgggataagcttctggaggaaggcgagaatgagcacacgtatgacgtccgctaccgggatgaatacgacgatgaatatccagagccatcaaaggtctatcgggtgaagtgccagcacaccggcactctcgaaccgtccgatctcttggactacttgacctcagccaatgcgacaaatatgttcgacagaaagccagagattctccaagctatgaacattgtcctgggccatcagcccaaaatcgacccgaacatttactcagtgggtgccaatagacactttgccatcgctcagggtcagaaagagggttacaacctcggagatgggctcgaggctcttcgtggattttttgtgagcgtccgtgctgcaactagtcgcctgctcgtcaatgttcaagtcaaatatgcggcctgctaccaggagggcgcgctagcggacttgataaccagttatcagcccaaccgtttcgagttccactccctgcaacgtttcttgaaaaacttgagaatccgggcaacacacattgaacgcaaaaacaagcagggagtaatcatcccacgtttcaagagaatcgctagtctggctaacacgggagatggcgcatcgctgccacatcctccgacggtccctcgtctgggagccggtcccaatgatgtgaaattctggttggacgaagctggccaacagtcatcgcagcagcagtccgcatcctcgaagaagaagggcaaaaagccagccacagctgggcctccgccggctggaagatacatcagtgtggcggaattcttcaacgagcgttacaatatgacaaatctagatccccgaatgccagtgatgaatgtcgggactcgcgagaatcctagctatttacccgtcgaagtctgcaacgtcgaacctgggcagcaagctaagaccaagctgagcccctaccagacaagggaaatgttgaaatttgcagtcaatgttccgccagtcaacgctcagtcaattgtgaataatggaactcgcatcctcgggctcagtgctgcttcaaatgctactttgaaagagtttggtatccaagcagatccccgactcatcacagtacccggccgcatccttgaggcccctcagatcttctacaaagacgcaaacaacaaagagaagagactctcgtccagcggtggcagctggaatatgaggtctatcaaattctcaatcggctcaagcttaggttcctgggcctggcttttcttggactccagcccaactagagcccccacgcgtgaggtactgggggccgccctggaacattttgtgacgaagctgagagaggtcggggttcaggctaatccccctcaaggcggagagcgcgtcgttctcgctcgcggtgacgtggatgatcagattggtggcgctgtcaagagactgatggccgctcataagcctaccatgattcttggtattcttaccgaccaaagcacggaagtttataactgcatgaagcgagtctgtgacgttcgggagggtgtccgcaatgtgaatgtgcttgttaaaaacttcacgactgacaagggccgcgaacaatacctcgccaacgtcggtctgaaggtcaatctgaagctcgggggtgcgaatcagctgattcctagagagcttgggatagtgagcaagggcaagactatgcttgttggtatcgatgtgacccacccctctcccgggtcatcctcaaaagcccccagtgttgcgggaatggttgcctcgattgattcctacttgggtcaatggccagcagaacttcggatccaaacatcgcgccaagaaagggtcagtgagttggacacgatgctgaaagctcacctcggtcggtgggctaaaaccaacaagggtcagtatccggataatattattgtctaccgcgacggagtctctgaagggcagtatgaaatggttgtcgaagaagaactacccctcctcaaaagcgcttgcaagcagctgtacccagcaacggagcatgccaaagggctaccacggatctcggtcgtgattgtgggcaagcggcatcacacgcgtttctatcctacgcgtaaagaggacgccgatggccacttgaatcctaagaatggtactgtggtcgaccgcggtgtgacggaagcccgcaactgggagttctacctacaggctcacactgctctcaagggcaccgctcgcccggcacactattttactgtttgggacgagatcttctgtcgagagaaacccaaggaaggacagaacacagctgacatcctggaagacctcacgcacaagatgtgctatctgttcggacgggcgaccaaggccgtgagcatctgccctcctgcatattatgccgatctggtctgcgagcgagcgcgatgctatttgtctgatctgtacgatgcgacgccgaccggtagcgttgtcaccggcggtggtgggggtggtgctcatgccgtggacggcggcagggtcaccatccatcccaacgtcaaggatacgatgttctacatttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]