2025-04-04 14:04:20, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_040293040 3476 bp mRNA linear ROD 22-MAR-2021 DEFINITION PREDICTED: Ictidomys tridecemlineatus nuclear factor kappa B subunit 1 (Nfkb1), transcript variant X3, mRNA. ACCESSION XM_040293040 VERSION XM_040293040.1 DBLINK BioProject: PRJNA714113 KEYWORDS RefSeq. SOURCE Ictidomys tridecemlineatus (thirteen-lined ground squirrel) ORGANISM Ictidomys tridecemlineatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciuromorpha; Sciuridae; Xerinae; Marmotini; Ictidomys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024405301.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ictidomys tridecemlineatus Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3476 /organism="Ictidomys tridecemlineatus" /mol_type="mRNA" /isolate="GS200" /db_xref="taxon:43179" /chromosome="Unknown" /sex="female" /tissue_type="liver" /collection_date="2010" /collected_by="Sandy Martin, University of Colorado, Anschutz Medical Campus" gene 1..3476 /gene="Nfkb1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:101972573" CDS 301..2829 /gene="Nfkb1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X3" /protein_id="XP_040148974.1" /db_xref="GeneID:101972573" /translation="
MVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNDVSKRDPEDCGKSGGREIVNLSGNIIKTTEQDKLGMSMDRNEEVTLLCTRGVKEEDSLFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSVLLKHKKAALLIDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMAANWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIKELVEALRQMGYTEAIQVIQAAFCTSEASSPVKTTSQAHSLPFLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTSSSSLLTLNKMPHDYGQEGPIEGKI"
misc_feature <301..636 /gene="Nfkb1" /note="N-terminal sub-domain of the Rel homology domain (RHD); Region: RHD-n; cl08275" /db_xref="CDD:447596" misc_feature 655..960 /gene="Nfkb1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(658..660,664..672,676..684,802..810,847..849, 883..885,940..942,949..951,955..957) /gene="Nfkb1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(664..669,673..675,712..714,718..720,724..726, 823..828,835..837,841..843) /gene="Nfkb1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(727..729,733..735,826..831) /gene="Nfkb1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1390..2178 /gene="Nfkb1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature order(1528..1530,1534..1536,1546..1551,1558..1566, 1570..1575,1585..1587,1594..1596,1639..1641,1645..1647, 1651..1653,1663..1668,1675..1683,1687..1692,1702..1704, 1711..1713,1738..1740,1744..1746,1750..1752,1762..1767, 1774..1782,1786..1791,1801..1803,1810..1812) /gene="Nfkb1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1528..1641 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1645..1740 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1852..1944 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1954..2052 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2350..2574 /gene="Nfkb1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
ccccacagacaacttgttttccaacccatctgcggatctagaggtgatgctgaagctttcctgtggtctccatcctttctcccatcctggtagaatcctcccctggtggattccagagcagagtccttcagcccaccttcacttccttgaagtctcctggagatttgcaactatgtgggacctgcaaaggtgattgttcagttggtcacaaatgggaaaaatatccacctgcacgcccacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgccggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgacagacgcgtgtgtcaggggctacaatccgggacttctcgtgcatcctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcggctcttcagcagactaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcccgacagcaccggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcccccaatgcatccaatttgaaaattgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcggttttatgaagaggaggaaaatggtggagtttgggaaggatttggagatttctcccccacagatgttcatagacaattcgccatcgtcttcaaaaccccaaagtataaagatgtcaacattacaaagccagcctctgtcttcgtccagcttcggagaaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcagatagtttcggcggcggcagtggtgccggggctggaggtggaggcatgttcggtagcggcggtggaggagggagcactggaagtacgggtccagggtacggcttcccgcactatggatttcctacatacggtggaattaccttccaccctggaaccactaaatccaatgctgggctgaagcatggaaccatgaatgatgtatctaaaagggatcctgaagattgtggcaagagtggtggcagagagattgtaaatctctctgggaacattatcaaaaccacagaacaagataaactgggcatgtccatggacagaaatgaggaggtgacgctgctgtgcaccaggggagtaaaggaagaggactctctgtttcaggataacctctttctggagaaggctatgcagcttgccaagcggcatgccaacgcccttttcgactatgcggtgacgggagatgtgaagatgctgctggctgtccagcggcacctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagagatctgctagaagttacatctggtttgatttctgatgacattatcaacatgagaaacgatctgtaccagacgcccttgcacttggcagtgatcactaagcaagaagatgtggtagaggacttgctgagtgccggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtgtcttactcaagcacaaaaaggcagcactacttatcgatcatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaacagcctgccgtgtctgctgctgctggtggccgccggagcagacgtcaatgctcaggagcagaagtccgggcgaacagcactgcacctggctgtggagcatgacaacatctccttggcaggctgcctgctcctggagggagatgcccacgtagacagtaccacctatgatggaactacacccctacacatcgcagccgggagagggtccaccaagctggcagctcttctaaaagcagcaggagcagatcccctggtggagaactttgagcccctttatgacctggatgactcttgggaaaaggcaggagaggacgaaggggttgtgcctggaaccacacccctagacatggccgccaactggcaggtatttgacatcttaaatgggaagccgtatgagccagagtttacatctgaggatttgctggcacaaggagacatgaaacagctgaccgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaataatgctttccggctgagtcctgctccttccaaaactctcatggacaactatgaggtctctggggggaccatcaaagagctggtagaggccctgagacagatgggctacaccgaagcaatccaagtgatccaggcggccttctgcacctcggaagcctccagccccgtgaagaccacctctcaggcccactcactgcctttcttgccttcctctacaaggcagcaaatagatgagcttcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccagcagcagctcattgctaactctcaacaaaatgccccacgattatgggcaggaaggacctatagaaggcaaaatttagccttcgggcagtttcccatgctgtgtaaaccaaagtcctaaaattccactgcattgtccaaaagaaggaaggtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggccgtctaaacgtggcttcctttcctggtttttcaatgagttttagttgattcacttgcagataagtatctagcaatccccctcactgcactgaactgatgtgacctggggatgaggtagtttattgagctttactggctgctgctggattacagttgctttttttgtcgtcattgctgctgtccctctgctgcattcccactgtcattaaagggtgtccccacctggtgttctttctagccgtccagggcacagttgtgcattcagattaaggattaagaaaagaggtgttttaaaatcagagtcacttagtgtgcaattaaaaaagaaaggctcattgctttttctaatgtggttatctcagtgatttggaaaaaagaagaatttatcaatatttaaacatggttataatcagtgccgaaaatgatattttcccctttttctgcattttgctattgtaaatatgtttttttttagatcaaatactttaaaggaaaaatgttggattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]