GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-17 01:24:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_039851022            2820 bp    mRNA    linear   MAM 02-MAR-2021
DEFINITION  PREDICTED: Pteropus giganteus argonaute RISC catalytic component 3
            (AGO3), transcript variant X3, mRNA.
ACCESSION   XM_039851022
VERSION     XM_039851022.1
DBLINK      BioProject: PRJNA703023
KEYWORDS    RefSeq.
SOURCE      Pteropus giganteus (Indian flying fox)
  ORGANISM  Pteropus giganteus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Megachiroptera;
            Pteropodidae; Pteropodinae; Pteropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024353787.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pteropus giganteus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2820
                     /organism="Pteropus giganteus"
                     /mol_type="mRNA"
                     /isolation_source="ENVO:00010625"
                     /db_xref="taxon:143291"
                     /chromosome="Unknown"
     gene            1..2820
                     /gene="AGO3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 mRNAs, 7 Proteins, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 9 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:120593272"
     CDS             136..2577
                     /gene="AGO3"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X2"
                     /protein_id="XP_039706956.1"
                     /db_xref="GeneID:120593272"
                     /translation="
MMESKDLVPECRKWWLREVVDSMVQHFKVTIFGDCRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    211..495
                     /gene="AGO3"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    523..675
                     /gene="AGO3"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    676..1038
                     /gene="AGO3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(832..834,877..879,919..921,931..933,985..987,
                     1006..1008,1012..1014)
                     /gene="AGO3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1171..2448
                     /gene="AGO3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1582..1584,1594..1596,1630..1641,1648..1650,
                     1672..1674,1681..1683,1693..1695,1705..1707)
                     /gene="AGO3"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1786..1788,1792..1794,2002..2004,2416..2418)
                     /gene="AGO3"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ctctatgggcaaacccattaaattactggctaactgttttcaagttgaaattccaaagattgatgtctacctttatgaggtagatattaaaccagacaagtgtcctagaagagtgaacagtctgtgcaccagagcatgatggagtcaaaagacttggtaccagaatgtaggaagtggtggttgagggaggtggttgactcaatggttcaacattttaaagtaactatatttggggactgtagaccagtttatgatggaaaaagaagcctttacacagccaatccacttcctgtggcaactactggggtagatttagatgttactttacctggggaaggtggaaaagatcgaccttttaaggtgtcaatcaaatttgtctctcgggtgagttggcacctactacatgaagtcctgacaggacgtaccttgcctgagccactggaattagacaagccaatcagcactaatcctgtccatgctgtcgatgtggtgctacgacatctgccctccatgaaatacacgcctgtggggcgttcctttttctcagctccagaaggatatgaccaccctcttggaggaggcagggaagtatggtttggattccatcaatctgttcggcctgccatgtggaaaatgatgcttaatattgatgtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcacaatatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacgtatctgccactagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaaccgacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtatgggacatgcgaggaaaacagttccacacaggagttgaaatcaaaatgtgggctatagcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacatactctgggctgcagctcattattgtcatcctgccagggaagacgcccgtgtatgcggaggtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaatgtaataaaaacatcccctcaaactctctcaaacctgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccatctgtgttccagcaaccagtgatctttttgggagcagatgtcactcatccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggacgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcggttcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttcggcaggtgttatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagattatcaacctggaataacttacattgtagttcagaagagacatcacactcgattattttgtgctgacaggacagaaagggttggaaggagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaaagtccaagattattctctgagaggaagaactgaaagatgaatcgacatacaacgtgtttccagtggagttcgttgagtggggatgcctgcagccatacagaaaccaacactgtggggaccagggtctgatttttatgttgatacaagtaagattgtttacttcatcaaggaacacagcactattatgcaatatgaaaccagccaacagcgcttttgtgcggtctcctgtaggaagtatcgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]