LOCUS       XM_037215152            2406 bp    mRNA    linear   INV 06-NOV-2020
DEFINITION  PREDICTED: Pollicipes pollicipes copper-transporting ATPase 2-like
            (LOC119092175), mRNA.
ACCESSION   XM_037215152
VERSION     XM_037215152.1
DBLINK      BioProject: PRJNA624368
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Pollicipes pollicipes
  ORGANISM  Pollicipes pollicipes
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea;
            Multicrustacea; Cirripedia; Thoracica; Thoracicalcarea;
            Pollicipedomorpha; Pollicipedidae; Pollicipes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023596297.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pollicipes pollicipes Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 26% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2406
                     /organism="Pollicipes pollicipes"
                     /mol_type="mRNA"
                     /isolate="AB1234"
                     /isolation_source="Intertidal rocks in small coastal
                     promontory heavily exposed to wave action"
                     /db_xref="taxon:41117"
                     /chromosome="Unknown"
                     /tissue_type="whole adults"
                     /dev_stage="adult"
                     /geo_loc_name="Spain: Pontevedra, Nigran, Cape Monteferro"
                     /lat_lon="42.155917 N 8.849778 W"
                     /collection_date="04-Jan-2018"
                     /collected_by="Marcos Perez-Losada"
     gene            1..2406
                     /gene="LOC119092175"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 77% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:119092175"
     CDS             385..2406
                     /gene="LOC119092175"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like"
                     /protein_id="XP_037071047.1"
                     /db_xref="GeneID:119092175"
                     /translation="

MTPSGRGGAGTMMTQLVDLEPPEMTATISIKGMTCQSCVRNIETTVGDNAGIHSIVVSLPDESATVTFDPQLTSPQGICDMIDDMGFDASLPAAAGGGGDGAGDGASRTVVLDIGGMTCQSCVRNIEATVGGRPGVRAVRVDLAAARGWLEVAPELADQQLIDWVEEMGFEARLAAELQCRLAIENMSCQSCVRNIEGKVAAQPGVLGVKVDLEAKEGVITYNPQVTSPGTLEDFVNGIGKFRAAVKPPSDGSSTGPAQDKPDGRSDSPPRQALLSARTPGESPRSPPKPPRSPQSATRSPEKTPVSPGKSTRSAADELETCTVSIRGMTCASCVSAIEKHMNKVDGVESILVALLAGKAEVQYDPAVLLPSQVAGLISDIGFPAQLLENHSPEGTLDLEIRGMTCASCVHTIETNVVRRPGVVSVSVALATERGRVVFDPGQTGPRDIIQAIEDLGFEAALRSGKQGSASYLDHREEIAKWRNSFLVSLFFGVPCMLIMFIGGRHFYVAAVKSLRHGAASMDVLIMLATTVSYVYSVAVVVAAMLLQESGKTSEALAKLISLQPTEAVLVTLGENREVLTEDSISVELVHRGDILKVVPGAKVPVDGRVLSGHSLCDESLITGESMPVAKKPAESKIKPSRLAAADTDAARFSNSSQRLPEHDRHQASTTHG"

     misc_feature    463..654
                     /gene="LOC119092175"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(481..489,496..498)
                     /gene="LOC119092175"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    715..903
                     /gene="LOC119092175"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(733..741,748..750)
                     /gene="LOC119092175"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    925..1104
                     /gene="LOC119092175"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1351..1539
                     /gene="LOC119092175"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1369..1377,1384..1386)
                     /gene="LOC119092175"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1567..>2283
                     /gene="LOC119092175"
                     /note="Cation-transporting P-type ATPase [Inorganic ion
                     transport and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:441819"
ORIGIN      

cgtcggaggcggtggtaacctccaaggctagtaatctcgtcagcctggtaggggaacaagctcgttttgtctcttcggtgtttaggcacacagcagcggacgcctgaagcctctgggaggcattacgaagtgtaccggcgtcgcgccgggcagcagccgccggccgcggcgcgtgagtgacgtcatagcgaactccggcctgccggtgcggcgggcggcatccggccggccggctgtcaagtgccgggcaggctccgtgcctggtgggtggcgaccgtggggcggctacctggccgtgcgcggtcgcggcggccccggacggagacggccgtcacggacgacggagtgacgtgacgcgcgtgtgacgtcaacgggacggccaggatgacgccgtcgggcagaggcggagcgggcacgatgatgacccagctcgtggacttggaaccgcccgagatgactgccaccatcagcatcaaaggcatgacctgccagtcttgcgtgcgcaacatcgagacgacggtcggcgacaacgccggcatccactccatcgtcgtctcgctgccggacgagagcgccaccgtgaccttcgacccgcagctgacctcaccgcaaggcatctgtgacatgatcgacgacatgggcttcgacgcgtcgctgccggcggcggccggcggcggcggcgacggcgcgggcgacggagcctcgcgcacagtcgtgctcgacatcggcggcatgacgtgccagtcgtgtgtgcgcaacatcgaggcgacggtcggcggccggccgggcgtgcgcgccgtgcgcgttgacctggcggcggcgcgcggctggctggaggtggcgcccgagctcgccgaccagcagctgatcgactgggtggaggagatgggcttcgaggcgcgcctggccgccgagctgcagtgccgcctggccatcgagaacatgagctgccagtcgtgcgtgcggaacatcgagggcaaggtggccgcccagccgggggtgctcggcgtcaaggtggacctggaggccaaggagggcgtcatcacctacaacccgcaggtcacttctcccggcacgctggaggacttcgtcaacggcatcgggaagtttagggccgccgtgaagccaccgtcggatggatcttccacaggacccgcgcaggacaagccggacggccggtcggactcgccgccgcggcaggcgctgctctcggcccgcacgccgggcgagtcgccgcgctcgccgccgaagccgccgcgctcgccgcagagcgccacccgtagcccggagaagacgcccgtcagtccagggaagtcaacacgctcggcggccgacgagctggagacgtgcaccgtctccatccgcggcatgacgtgcgccagctgcgtcagcgccatcgagaagcacatgaacaaggtggacggtgtggaatcgatcctggtggcgctgctggctggcaaagccgaggtgcagtacgacccggccgtgctgctgccctcgcaggtggccggcctgatctccgacattggcttcccggcccagctgctggagaaccacagcccggagggcacgctcgacctcgagatccgcgggatgacctgcgcctcgtgcgtgcacacgatcgagacgaacgtggtgcggcggccgggcgtggtgtccgtgtcggtggcgctggcgacggagcgcgggcgggtcgtgttcgacccgggccagacgggaccgcgagacatcatccaggcgatcgaggacctgggcttcgaggcggcgctccgctcgggcaagcagggcagcgcgtcgtacctggaccaccgcgaggagatcgccaagtggcgcaactcgttcctggtgtcgctgttcttcggcgtgccgtgcatgctcatcatgtttatcggcggccggcacttctacgtggcggcggtgaagtcgctgcgccacggcgccgcctccatggacgtgctcatcatgctggccacgaccgtgtcgtacgtgtactcggtggccgtggtggtggcggccatgctgctgcaggagtcgggcaagacgtctgaggcgctggccaagctgatctcgctgcagcccactgaggcggtgctggtgacgctgggggagaacagggaggtgctcacagaggacagcatctccgtcgagctggtgcaccgcggcgacatcctcaaggtggtgcccggcgccaaggtgccggtggacggccgtgtcctcagtggccactccctgtgcgacgagtccctcatcaccggcgagtccatgcccgtcgccaagaagccagccgagtccaaaatcaagccatcgcggcttgcggcagcggacaccgacgccgcacgattcagcaacagctcacaacggctccccgaacatgaccggcaccaggccagcacaactcacggatga

//