2025-08-20 02:53:37, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS XM_036253247 3619 bp mRNA linear MAM 29-SEP-2020 DEFINITION PREDICTED: Molossus molossus nuclear factor kappa B subunit 1 (NFKB1), transcript variant X2, mRNA. ACCESSION XM_036253247 VERSION XM_036253247.1 DBLINK BioProject: PRJNA665629 KEYWORDS RefSeq. SOURCE Molossus molossus (Pallas's mastiff bat) ORGANISM Molossus molossus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yangochiroptera; Molossidae; Molossus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023425344.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Molossus molossus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3619 /organism="Molossus molossus" /mol_type="mRNA" /isolate="mMolMol1" /db_xref="taxon:27622" /chromosome="Unknown" /sex="male" /tissue_type="muscle" /dev_stage="adult" /geo_loc_name="Panama: Gamboa" /lat_lon="9.1165 N 79.6965 W" /collection_date="2018" /collected_by="Dina Dechmann" gene 1..3619 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 9 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:118624789" CDS 56..2965 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X2" /protein_id="XP_036109140.1" /db_xref="GeneID:118624789" /translation="
MAEEDPYLGGHEQMFHLDPLNHTIFNSEIFQSEMPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQIKICNYSGPAKVIVQLVTNGKSIHLHAHSLVGKHCEDGICTVMAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGAGAGGGGMYGSGGGGGGTGSAGPGYGFPHYGFPYGGITFHHGATKSNAGMKHGAMDTSSKNDPGGCEESDDREAVSLSGEGTKTPEQHKGSSSRDDEATLAYPVGVKEENSGFLDSLFLEKAMQLARRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDCVLHLAIIHLHAQLVRDLLEVTSGLVLDDIINMRNDLYQTPLYLAVITKQEAVVEDLLRAGVDLSLLDHLGNSVLHLAAKEGHDRILGTLLKHKKAALLIDHPNGEGLNAIHIAVMSNSMPCLLLLVAAGADVNAQEQKSGRTALHLAVEQDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRMAALLKAAGADPLLENFEPLYDLDDSWEKDGDDEGVVPGTTPLDMATNWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDTKLQLYKLLEFPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELMEALRQMGYTEAIEVLQAAFCASGTAGPSPLETAPQAHSRPLSPASTRQQLDELRDDSICDSGVETSFRKLSFTESLTSGSSLLTLNKMPHDYGQEGPIEGKI"
misc_feature 176..781 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(218..220,224..229,233..238,245..256,479..481, 485..490,779..781) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 800..1105 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(803..805,809..817,821..829,947..955,992..994, 1028..1030,1085..1087,1094..1096,1100..1102) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(809..814,818..820,857..859,863..865,869..871, 968..973,980..982,986..988) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(872..874,878..880,971..976) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1523..2311 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature 1676..1774 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1784..1873 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1877..1981 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1985..1987,1991..1993,2003..2008,2015..2023, 2027..2032,2042..2044,2051..2053,2078..2080,2087..2089, 2093..2095,2105..2110,2117..2125,2129..2134,2147..2149, 2156..2158,2183..2185,2189..2191,2195..2197,2207..2212, 2219..2227,2231..2236,2246..2248,2255..2257,2282..2284) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1985..2080 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2087..2185 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2189..2284 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2483..2707 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
cggggagcccgcaggcgccgggaggccgcgcgccgacgcgccaccaggctccaaaatggcagaagaggatccatatttgggagggcatgaacaaatgtttcatttggatcctttgaatcatacaatatttaattcagaaatatttcagtcagagatgccactgccaacggatggcccataccttcaaatattagagcaacccaaacagagaggatttcgtttccgttatgtctgtgaaggcccgtcccatggcggactccccggtgcatctagtgagaagaataagaagtcctaccctcagatcaaaatctgcaactactcgggacctgccaaggttattgttcagttggtcacaaatggaaaaagcatccacctgcacgcacacagcctggtggggaagcactgtgaggacgggatctgcaccgtaatggctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcatgtataaggggctataatcccggacttttggtgcatcctgatcttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagctttcctcccagacagcaccgggagcttcaccaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaacgcgtccaacttgaaaattgtacgaatggacaggacagctggatgcgtcactggaggggaagaaatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggaatctgggaaggatttggagatttttcccctacagacgttcacagacaatttgccatcgtcttcaaaacaccaaagtataaagacatcaacattaccaaaccagcctctgtgtttgtccaactacggaggaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagacaaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcggacagctttggcggcggtggtgccggggctggaggcggaggcatgtacggcagcggcggtggaggagggggcacaggaagcgccgggccagggtatggcttcccccactatggatttccatatggtggaatcaccttccaccatggagccactaaatctaatgctgggatgaagcatggagccatggacacatcatctaaaaatgaccctggaggttgtgaggagagtgatgacagagaggctgtaagtctctctggggaaggaaccaaaaccccagagcaacataaggggtccagcagcagagatgatgaggctactctggcctatccagtgggagtgaaggaagagaattctgggtttctggacagcctcttcctggagaaggcaatgcagcttgccaggcggcacgccaacgccctgtttgactatgcggtgacaggagatgtgaagatgctgctggctgtccagcgtcacctcactgccgtgcaggatgagaacggggactgtgtcttacacttagcaatcatccacctccatgctcaacttgtgagggatctgctagaagtcacttctggtttggttttagatgacattatcaacatgagaaatgatctgtaccagacgcccttgtacttggcagtgatcaccaagcaggaggctgtggtggaggacttgctcagggctggggtcgatctgagccttctggaccacttgggtaactctgttttacacctagctgccaaagaaggacatgatagaattctcggtactttactcaagcacaaaaaggcagcactacttatcgaccaccccaatggggaaggtctgaacgccatccacatcgcggtgatgagcaacagcatgccctgtctgctgctgctggtggccgccggggcggacgtcaacgcgcaggagcagaagtcgggtcgcacggcgctgcacctggctgtggagcaggacaacatctccctggctggctgtctgctcctggagggtgatgcccacgtagacagtaccacctacgacggaactacaccgctgcacatagcggccgggagaggctccacccggatggcagcccttctgaaagcagcaggagcagatcctctgctggagaactttgagcctctctatgacctggacgattcctgggaaaaggatggagatgatgaaggagttgtgcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaagccgtatgagccagagtttacatctgatgatttattggcacaaggagacatgaaacagctgactgaagacacaaagttgcagctttacaagttgctagaatttcccgatccagacaaaaactgggcaactctggcacagaaattaggtctggggatactcaataatgccttccggctgagtcctgctccttctaaaacgctcatggacaattacgaggtctctggagggaccataagagagctgatggaagccctgaggcagatgggctacaccgaagcgatcgaggtgctccaggccgccttctgcgcctcaggaactgcaggccccagcccactggagaccgccccgcaggcccactcgcggcctctctcacccgcctccaccagacagcaactagacgagctccgagacgacagcatctgtgacagcggcgtggagacatccttccgcaaactcagcttcacggagtctctgaccagcggcagctcattgctaactcttaacaaaatgccccacgattacgggcaggaaggacctatagaaggtaaaatttagccttctggcagttcccagcatcctgtaaaccaaagttctgaaattccactggactgtccaagagaaggaagggaaagtgcatccaggggtgctcagaggaacaccggccgccctggacagcgctgggcttcactcgaggcctctgagacccggctgccttcctcggctctccagggaatttcagcccggctcactggcatatagtctctagcaggcacggccttcggcggggctggtgcctcgtggaggtgaggtaccttgttgagctttaccggctgcttcctgtcatcattgctgctccccctctgctgtgtccccactgccattacaaggttaagtccccacctggtgtctttctcgccggccacagcacagtcgtgcactcagattaagaattaaggaaattcttaatattttatcaagaatattttaaataagatattttaaaaggcgccatcagtgtataattgaaagaggcttactgctttttctcacgtggtgtatctctgtgatttgaaaaaagaacatgtatgtgtcgatatttaaacatggttacaatcagtgctgaaaatggtcttttcccctttttctgcattttgctattgtaaatatgtttttagatcaaatactttaaaagaaagaatgttggattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]