2025-08-20 02:52:15, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS XM_036253237 3622 bp mRNA linear MAM 29-SEP-2020 DEFINITION PREDICTED: Molossus molossus nuclear factor kappa B subunit 1 (NFKB1), transcript variant X1, mRNA. ACCESSION XM_036253237 VERSION XM_036253237.1 DBLINK BioProject: PRJNA665629 KEYWORDS RefSeq. SOURCE Molossus molossus (Pallas's mastiff bat) ORGANISM Molossus molossus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yangochiroptera; Molossidae; Molossus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023425344.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Molossus molossus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3622 /organism="Molossus molossus" /mol_type="mRNA" /isolate="mMolMol1" /db_xref="taxon:27622" /chromosome="Unknown" /sex="male" /tissue_type="muscle" /dev_stage="adult" /geo_loc_name="Panama: Gamboa" /lat_lon="9.1165 N 79.6965 W" /collection_date="2018" /collected_by="Dina Dechmann" gene 1..3622 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 14 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:118624789" CDS 56..2968 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X1" /protein_id="XP_036109130.1" /db_xref="GeneID:118624789" /translation="
MAEEDPYLGGHEQMFHLDPLNHTIFNSEIFQSEMPLPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQIKICNYSGPAKVIVQLVTNGKSIHLHAHSLVGKHCEDGICTVMAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGAGAGGGGMYGSGGGGGGTGSAGPGYGFPHYGFPYGGITFHHGATKSNAGMKHGAMDTSSKNDPGGCEESDDREAVSLSGEGTKTPEQHKGSSSRDDEATLAYPVGVKEENSGFLDSLFLEKAMQLARRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDCVLHLAIIHLHAQLVRDLLEVTSGLVLDDIINMRNDLYQTPLYLAVITKQEAVVEDLLRAGVDLSLLDHLGNSVLHLAAKEGHDRILGTLLKHKKAALLIDHPNGEGLNAIHIAVMSNSMPCLLLLVAAGADVNAQEQKSGRTALHLAVEQDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRMAALLKAAGADPLLENFEPLYDLDDSWEKDGDDEGVVPGTTPLDMATNWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDTKLQLYKLLEFPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELMEALRQMGYTEAIEVLQAAFCASGTAGPSPLETAPQAHSRPLSPASTRQQLDELRDDSICDSGVETSFRKLSFTESLTSGSSLLTLNKMPHDYGQEGPIEGKI"
misc_feature 179..784 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(221..223,227..232,236..241,248..259,482..484, 488..493,782..784) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 803..1108 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(806..808,812..820,824..832,950..958,995..997, 1031..1033,1088..1090,1097..1099,1103..1105) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(812..817,821..823,860..862,866..868,872..874, 971..976,983..985,989..991) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(875..877,881..883,974..979) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1526..2314 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature 1679..1777 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1787..1876 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1880..1984 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1988..1990,1994..1996,2006..2011,2018..2026, 2030..2035,2045..2047,2054..2056,2081..2083,2090..2092, 2096..2098,2108..2113,2120..2128,2132..2137,2150..2152, 2159..2161,2186..2188,2192..2194,2198..2200,2210..2215, 2222..2230,2234..2239,2249..2251,2258..2260,2285..2287) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1988..2083 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2090..2188 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2192..2287 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2486..2710 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
cggggagcccgcaggcgccgggaggccgcgcgccgacgcgccaccaggctccaaaatggcagaagaggatccatatttgggagggcatgaacaaatgtttcatttggatcctttgaatcatacaatatttaattcagaaatatttcagtcagagatgccactgccaacggcagatggcccataccttcaaatattagagcaacccaaacagagaggatttcgtttccgttatgtctgtgaaggcccgtcccatggcggactccccggtgcatctagtgagaagaataagaagtcctaccctcagatcaaaatctgcaactactcgggacctgccaaggttattgttcagttggtcacaaatggaaaaagcatccacctgcacgcacacagcctggtggggaagcactgtgaggacgggatctgcaccgtaatggctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcatgtataaggggctataatcccggacttttggtgcatcctgatcttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagctttcctcccagacagcaccgggagcttcaccaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaacgcgtccaacttgaaaattgtacgaatggacaggacagctggatgcgtcactggaggggaagaaatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggaatctgggaaggatttggagatttttcccctacagacgttcacagacaatttgccatcgtcttcaaaacaccaaagtataaagacatcaacattaccaaaccagcctctgtgtttgtccaactacggaggaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagacaaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcggacagctttggcggcggtggtgccggggctggaggcggaggcatgtacggcagcggcggtggaggagggggcacaggaagcgccgggccagggtatggcttcccccactatggatttccatatggtggaatcaccttccaccatggagccactaaatctaatgctgggatgaagcatggagccatggacacatcatctaaaaatgaccctggaggttgtgaggagagtgatgacagagaggctgtaagtctctctggggaaggaaccaaaaccccagagcaacataaggggtccagcagcagagatgatgaggctactctggcctatccagtgggagtgaaggaagagaattctgggtttctggacagcctcttcctggagaaggcaatgcagcttgccaggcggcacgccaacgccctgtttgactatgcggtgacaggagatgtgaagatgctgctggctgtccagcgtcacctcactgccgtgcaggatgagaacggggactgtgtcttacacttagcaatcatccacctccatgctcaacttgtgagggatctgctagaagtcacttctggtttggttttagatgacattatcaacatgagaaatgatctgtaccagacgcccttgtacttggcagtgatcaccaagcaggaggctgtggtggaggacttgctcagggctggggtcgatctgagccttctggaccacttgggtaactctgttttacacctagctgccaaagaaggacatgatagaattctcggtactttactcaagcacaaaaaggcagcactacttatcgaccaccccaatggggaaggtctgaacgccatccacatcgcggtgatgagcaacagcatgccctgtctgctgctgctggtggccgccggggcggacgtcaacgcgcaggagcagaagtcgggtcgcacggcgctgcacctggctgtggagcaggacaacatctccctggctggctgtctgctcctggagggtgatgcccacgtagacagtaccacctacgacggaactacaccgctgcacatagcggccgggagaggctccacccggatggcagcccttctgaaagcagcaggagcagatcctctgctggagaactttgagcctctctatgacctggacgattcctgggaaaaggatggagatgatgaaggagttgtgcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaagccgtatgagccagagtttacatctgatgatttattggcacaaggagacatgaaacagctgactgaagacacaaagttgcagctttacaagttgctagaatttcccgatccagacaaaaactgggcaactctggcacagaaattaggtctggggatactcaataatgccttccggctgagtcctgctccttctaaaacgctcatggacaattacgaggtctctggagggaccataagagagctgatggaagccctgaggcagatgggctacaccgaagcgatcgaggtgctccaggccgccttctgcgcctcaggaactgcaggccccagcccactggagaccgccccgcaggcccactcgcggcctctctcacccgcctccaccagacagcaactagacgagctccgagacgacagcatctgtgacagcggcgtggagacatccttccgcaaactcagcttcacggagtctctgaccagcggcagctcattgctaactcttaacaaaatgccccacgattacgggcaggaaggacctatagaaggtaaaatttagccttctggcagttcccagcatcctgtaaaccaaagttctgaaattccactggactgtccaagagaaggaagggaaagtgcatccaggggtgctcagaggaacaccggccgccctggacagcgctgggcttcactcgaggcctctgagacccggctgccttcctcggctctccagggaatttcagcccggctcactggcatatagtctctagcaggcacggccttcggcggggctggtgcctcgtggaggtgaggtaccttgttgagctttaccggctgcttcctgtcatcattgctgctccccctctgctgtgtccccactgccattacaaggttaagtccccacctggtgtctttctcgccggccacagcacagtcgtgcactcagattaagaattaaggaaattcttaatattttatcaagaatattttaaataagatattttaaaaggcgccatcagtgtataattgaaagaggcttactgctttttctcacgtggtgtatctctgtgatttgaaaaaagaacatgtatgtgtcgatatttaaacatggttacaatcagtgctgaaaatggtcttttcccctttttctgcattttgctattgtaaatatgtttttagatcaaatactttaaaagaaagaatgttggattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]