2024-04-20 01:55:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035519055 2880 bp mRNA linear PLN 04-AUG-2020 DEFINITION Lasiodiplodia theobromae Rna interference and silencing protein (LTHEOB_9465), partial mRNA. ACCESSION XM_035519055 VERSION XM_035519055.1 DBLINK BioProject: PRJNA645153 BioSample: SAMN07172427 KEYWORDS RefSeq. SOURCE Lasiodiplodia theobromae ORGANISM Lasiodiplodia theobromae Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Dothideomycetes incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Lasiodiplodia. REFERENCE 1 (bases 1 to 2880) AUTHORS Ali,S.S., Asman,A., Shao,J., Balidion,J.F., Strem,M.D., Puig,A.S., Meinhardt,L.W. and Bailey,B.A. TITLE Genome and transcriptome analysis of the latent pathogen Lasiodiplodia theobromae, an emerging threat to the cacao industry JOURNAL Genome 63 (1), 37-52 (2020) PUBMED 31580730 REFERENCE 2 (bases 1 to 2880) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-AUG-2020) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2880) AUTHORS Bailey,B., Ali,S., Shao,J. and Meinhardt,L. TITLE Direct Submission JOURNAL Submitted (10-JAN-2020) Agricultural Research Services (ARS), United State Department of Agriculture (USDA), 10300 Baltimore Ave, Beltsville, MD 20705, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_023336511). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2880 /organism="Lasiodiplodia theobromae" /mol_type="mRNA" /strain="AM2As" /isolation_source="young plant" /host="Theobroma cacao" /db_xref="taxon:45133" /chromosome="Unknown" /country="Indonesia" /collection_date="Mar-2014" gene <1..>2880 /locus_tag="LTHEOB_9465" /db_xref="GeneID:56023761" CDS 1..2880 /locus_tag="LTHEOB_9465" /codon_start=1 /product="Rna interference and silencing protein" /protein_id="XP_035368692.1" /db_xref="GeneID:56023761" /translation="
MSHKKTTKSTQPDSGGDATNHLSLPYETGAFAGNSDGARSPNLSEDSYPSGSQRSSSYSPPQRSSSAAKTIRTHSRTASGVRVDDLSVVVTEQMGMVTIHERPATTINSTVGKHFEVDEPSGRICKHSVSYFSTSSQKQVKNRALKRQLLQKVLERHLTDSGGTKPIVEGIDAIYSKNPLHSGLQAAPSEMFFDITHQPKSSEEGTNFRIRVLRQPDVKFDNLAKSLQNCECSGTSACSAQDCFHTLNILLRSVLSQSEGWFCVNKNLWLSKEAMSIDAEVETSQYVKLHDGMTFSIDLTEKKCGSPSDRKLMLTVSPRPTLFVEACNLGVFYADYIDNFQEDAANKAKALRSFIKRLEVTQAYKPSRDDGAPRIIRAPQSPRDLPSNARRRQIVSLGQSATEQKFKLDEAGMATEEISVSCYFEQYYGYKLRFPNLPVVNVWDSAKKIWIPMELLWVKEQPVFKFPPLQMKDGFKPIHMKCEESVRNFDANLSDKHSKVVKLLNPTLLKDAFGITFKSEAENITAYFVDSPPEGPQEKHRHVKDKRIKAPKFADSPQMVRFLTLKSGLERHTRKEQEVFEGACKKLLVAFQTEGGLCDEPKAAYDYDTFQSFLGAVDNAESPLKRFSPKSDMLLLVGLDAAKEGQADTQARIRCWCDKNNVPTVFFDVQKFQENMKHWERSEKGTNVPEIRQAVGYARALVTKAVHRCAGRVPSTQEINPADREDLKKLLKETMVVGASLTSGQSDPSDDLPSIAAVTTSLGDDFVQYQGRFRLQKSGQKTIVNLSDMLKEMLSEYAQAHGNRLPESILYLREGISKDHFHLIRNDEIRKIADAFNELCTQKPQLVVSNAAPNITFIALSKRAKPRFFPDGDRIARLTAKNLKEGIVVDAMDIQVPTAKGREFDFHLQSHSNSCDSAKQCGFISNTHYYVLKHENGWSQEEVERIVSLTLPDSGLLWD"
misc_feature 1036..1368 /locus_tag="LTHEOB_9465" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1126..1128,1216..1218,1258..1260,1270..1272, 1324..1326,1345..1347,1351..1353) /locus_tag="LTHEOB_9465" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature <2194..2841 /locus_tag="LTHEOB_9465" /note="PIWI domain. Domain found in proteins involved in RNA silencing. RNA silencing refers to a group of related gene-silencing mechanisms mediated by short RNA molecules, including siRNAs, miRNAs, and heterochromatin-related guide RNAs. The central component...; Region: Piwi-like; cl00628" /db_xref="CDD:412485" ORIGIN
atgagccacaagaagaccaccaaatccactcagcctgattctggaggtgatgctacgaatcacctttctttaccgtacgaaacgggggcttttgccggcaactctgacggagctcgctccccaaacctcagcgaagattcgtatccaagcggatctcaacgctccagctcttactctcctccccaaaggtcatcatccgctgcaaagacaattcgtacccattcccgaacggccagcggtgtgcgtgtcgacgacttgtctgttgttgtcaccgaacaaatgggcatggtcactattcacgaacgccccgctacaaccatcaactcaacggtcggcaaacacttcgaagtagatgaaccctctgggcggatttgcaagcattcagtttcctacttttcaacaagttcccaaaagcaagtcaaaaacagagctctcaagcgccaattgttgcagaaagttcttgagcgtcatctcaccgattctggtggcaccaaaccaatcgttgaaggaattgatgcaatctactccaagaatcctctgcattcaggtttgcaagcggcgccgtctgagatgttttttgacatcacgcaccaaccgaagtcgtcagaggaaggaaccaactttcgaattcgagtacttcgccaaccggacgtcaagttcgataatctcgcaaagagcttacagaattgcgagtgcagcggtaccagcgcatgctctgcccaagactgtttccacaccctgaacatcttgttacgatcggttttgagccagagtgagggatggttctgcgtcaacaagaacctatggctttccaaggaggcgatgagcattgacgccgaagtcgagacgagccaatacgtcaaactgcatgacggcatgactttttccatcgatcttacggagaagaagtgcggttctccttccgatcgcaagctgatgctgaccgtcagccctcgtccaacgctgtttgtggaagcctgcaaccttggggttttctacgccgattacatcgacaacttccaagaagacgccgctaacaaggccaaagcccttcgctcattcatcaaaaggctagaagttacccaggcatacaagccgtctcgggacgatggagcacccaggattatcagagctccgcagagcccgagggacctcccgtcaaacgcccgtcgacgccaaatagtttcccttggtcagagtgccacggaacagaaattcaagcttgacgaagctggaatggccactgaagaaatctccgtgagctgctacttcgagcagtactacggctacaagctcagatttccaaatctccccgtggtgaacgtttgggacagtgcaaagaagatttggatcccaatggagctgctttgggttaaagagcagccagtcttcaagttcccgcccctccagatgaaagacggattcaagcccattcacatgaaatgtgaagagtcggttcgcaattttgatgccaacctcagcgacaagcacagtaaggttgtgaaacttctcaatcccacattgctgaaggatgcctttgggattacattcaaatcagaagcagagaatatcacagcctactttgtggactctccacctgaaggaccccaggagaagcataggcacgtcaaggacaagcgaatcaaggctccaaagtttgcagattctcctcaaatggtccgcttcttgactctgaagtctggattggagcggcatactaggaaagagcaagaggtttttgagggagcctgcaaaaagctgctcgtagcttttcaaacggaggggggcctctgcgacgagccaaaagcagcatatgactacgacactttccaatcgttccttggagcagtcgacaatgcagaatcacccctcaagcgattctctccaaagagtgacatgttgctcctcgtcggtcttgatgcggccaaggaggggcaggcagatacccaagccaggattagatgttggtgtgacaagaacaacgttccaacggttttctttgacgttcagaaattccaggaaaacatgaagcattgggaaaggagtgagaaggggactaacgtgccggagatcagacaagcggtggggtatgccagagctcttgtcacgaaggctgtccacaggtgcgccggtcgggttccgagtactcaggaaatcaacccagccgaccgtgaagacctcaagaagcttctgaaagagacaatggtggttggagcgtctttgacttctggccagagtgatccatcggacgatctgccttcaatcgcagcagtcacgacaagcctgggagacgacttcgtccagtatcagggccgcttccgcctacaaaagtctgggcagaagacaattgtgaatctcagcgacatgttgaaggagatgctatccgaatacgcacaagcccatggtaatcggctgccagagtcgatcctctatttgcgggaaggtatttcaaaggaccactttcacctcatcagaaatgatgaaatccgcaagatagcggatgccttcaacgagctttgcacacaaaagccgcagctggtcgtgtcaaacgcggcgccaaacatcaccttcatcgctctctcaaagcgtgcaaagcccagattcttccccgacggtgataggatcgcacgattgacggccaaaaatctgaaagaggggatagtcgtcgacgccatggacattcaggtaccgactgcgaaggggcgggagttcgacttccatctccagtcacactcgaattcctgcgacagtgccaagcagtgtggcttcatctccaacactcattactatgtgctgaagcacgaaaatggatggtcccaggaggaggttgagcgcattgtgagtctaactttgcccgattctggattgctgtgggactaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]