2025-07-10 01:02:13, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_034344404 1176 bp mRNA linear PLN 14-MAY-2020 DEFINITION PREDICTED: Prunus dulcis dr1-associated corepressor (LOC117615337), mRNA. ACCESSION XM_034344404 VERSION XM_034344404.1 DBLINK BioProject: PRJNA631757 KEYWORDS RefSeq. SOURCE Prunus dulcis (almond) ORGANISM Prunus dulcis Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Amygdaleae; Prunus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_047650.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Prunus dulcis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1176 /organism="Prunus dulcis" /mol_type="mRNA" /db_xref="taxon:3755" /chromosome="1" gene 1..1176 /gene="LOC117615337" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 mRNAs, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:117615337" CDS 71..895 /gene="LOC117615337" /codon_start=1 /product="dr1-associated corepressor" /protein_id="XP_034200295.1" /db_xref="GeneID:117615337" /translation="
MAEEQNVAREEDNIAGEEKAEQAEENAEQAEENAEQEEDDPEKAVENAAVKEKAKVAQEEENAEPIRSENSQIRPEFPNTRVKRIMKLDRGINKVNSEALLLVSCSAQLFLEFLAERSAEVATEKKRKIVKLEHMRVAVKRHRPTSDFLLDELPVPSQPSDHQPTDRSSSRTVSHAPAPARRDRNRSRAVSDKPAPAGTRRIDHFFRTKEIPIQTEQSLIETEEASIEIDEAPIETDEGPIETDEASIETDEASIETDEGPIETGEGPIETNES"
misc_feature 293..529 /gene="LOC117615337" /note="histone-fold domain found in DNA polymerase epsilon subunit 4 (POLE4) and similar proteins; Region: HFD_POLE4-like; cd22929" /db_xref="CDD:467054" misc_feature order(311..313,323..325,332..337,341..358,362..367, 371..379,383..418,452..466,500..502,512..517,524..526) /gene="LOC117615337" /note="heterodimer interface [polypeptide binding]; other site" /db_xref="CDD:467054" misc_feature order(332..334,338..340,362..364,395..397,404..409, 416..418,428..430,437..442,491..502,509..514,521..526) /gene="LOC117615337" /note="catalytic subunit binding site [polypeptide binding]; other site" /db_xref="CDD:467054" ORIGIN
ttcaaaaccctaacacaacattttcgtttttcgattacttattcctgaccagagagcgtcgcaaccatcaatggcagaagagcagaacgtagcacgagaagaagataacatagcaggagaagagaaagcagagcaagcagaagagaacgcagagcaagcagaagagaacgcagagcaagaagaagatgacccagaaaaagcagtagagaatgcagcagtaaaggaaaaagcgaaggtagcacaagaagaagagaacgcagaaccgatccgatccgaaaattcacagatccgacccgaatttccgaatactcgggtgaagaggataatgaagctggacaggggcatcaacaaggtaaattcagaagccttactccttgtatcgtgctccgcccagctcttcctggagttcctggcggagaggtcggctgaggttgcgacggagaagaagcgcaagatcgtgaagctcgaacacatgcgagtcgccgtcaagaggcatcgcccgaccagcgatttccttttggatgagcttcccgtgccctctcagccgtccgatcatcagcctactgatcgaagcagctcgcgcaccgtttcccatgctccagctccggctagacgagatcggaaccgctctcgcgccgtttccgataaaccagctccagctggcactcgccggatcgatcacttctttcggacaaaagaaatcccgattcagaccgaacaatccctaattgagaccgaggaagcttcaattgagatcgatgaagcccccattgagaccgacgaaggtccaattgagaccgatgaagcttcaatagagaccgacgaagcttcaatagagaccgacgaaggtccaattgagaccggtgaagggccaattgagaccaacgagtcctagatcttcgttcgttctttgcctgtcgtaaagaagcaaaatcattttgtttggtcaagttgtaattgtgagaaaccaatggaaaatatctgatggacacaaggagattaattctaatttttctttataatcaattttctatttttcctatggatttgatatttatgattgacctaagcactgcagtgaagctccacggcaatggggggaaaatctctaccgttctgctcccagcccatgtatgtttttgtgttgtttaatttaatgcaaaagttctttacttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]