2024-04-27 10:05:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_033615908 2583 bp mRNA linear VRT 20-APR-2020 DEFINITION PREDICTED: Epinephelus lanceolatus pinopsin-like (LOC117249974), mRNA. ACCESSION XM_033615908 VERSION XM_033615908.1 DBLINK BioProject: PRJNA625542 KEYWORDS RefSeq. SOURCE Epinephelus lanceolatus (giant grouper) ORGANISM Epinephelus lanceolatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Perciformes; Serranoidei; Serranidae; Epinephelinae; Epinephelini; Epinephelus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_047014.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Epinephelus lanceolatus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2583 /organism="Epinephelus lanceolatus" /mol_type="mRNA" /isolate="Andai001" /db_xref="taxon:310571" /chromosome="24" /sex="female" /tissue_type="blood and muscle" gene 1..2583 /gene="LOC117249974" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 28 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:117249974" CDS 465..1634 /gene="LOC117249974" /codon_start=1 /product="pinopsin-like" /protein_id="XP_033471799.1" /db_xref="GeneID:117249974" /translation="
MFSEVSDVDLTFNLGAPLSHLEQDWSDAPHERLSLSGHRVVSVCLGSIMVFGFLNNLLVLVLFCRFRSLRTPVNMLLLNISVSDMLVCACGTTLSFASSLRSRWLYGRTGCMWYGFVNSCFGIVSLVSLAVLSYDRYSTLMVYNKRVSDYRKPLLAVGAAWLYSVGWTVPPLLGWSSYGLEGAGTSCSVTWTERSSASHSYIVCLFVFCLGLPVLVMVYCYGRLLHAVKQVGHIRRTAARRREFHILFMIVTTVVCYLLCWMPYGVVAMMATFGRQGVVSPVAAVVPSILAKSSTVINPVIYILMNKQFYRCFLILLGCKHPLTESAHFAVPSKTTVVQLNRRPCDSSSRHATAAEPAPLTTQGSIHMEGTSAVKTDPAKPSDPASTVM"
misc_feature 582..1403 /gene="LOC117249974" /note="seven-transmembrane G protein-coupled receptor superfamily; Region: 7tm_GPCRs; cl28897" /db_xref="CDD:452889" misc_feature 585..659 /gene="LOC117249974" /note="TM helix 1 [structural motif]; Region: TM helix 1" /db_xref="CDD:410628" misc_feature 684..752 /gene="LOC117249974" /note="TM helix 2 [structural motif]; Region: TM helix 2" /db_xref="CDD:410628" misc_feature 798..866 /gene="LOC117249974" /note="TM helix 3 [structural motif]; Region: TM helix 3" /db_xref="CDD:410628" misc_feature 927..977 /gene="LOC117249974" /note="TM helix 4 [structural motif]; Region: TM helix 4" /db_xref="CDD:410628" misc_feature 1059..1130 /gene="LOC117249974" /note="TM helix 5 [structural motif]; Region: TM helix 5" /db_xref="CDD:410628" misc_feature 1203..1271 /gene="LOC117249974" /note="TM helix 6 [structural motif]; Region: TM helix 6" /db_xref="CDD:410628" misc_feature 1305..1382 /gene="LOC117249974" /note="TM helix 7 [structural motif]; Region: TM helix 7" /db_xref="CDD:410628" ORIGIN
gggttacttatatgtgagcgcgtggagcggagcgacagttgggcggcacgcaggaggacagagacttccgttctgtgagagcagagaagaagaagagtgagcgcggctcgtttatcacagaagaagtaatttattagcggattatcgatcctgtgatcgattacctgatatcgatcagagctggtgtctgttgccgccgccgctgctgcggcggaggatggagcggacagcaggagacggacggagcggcaggacgcttctcctgcggtagtctgactcctcttcatcatgtagctcctcttcatcatgtagctcctcttcatcatgtagctcctcttcatcatgtagctcctcttggcttttcactctctccacagaggacgtacccgcgcgctccgctccacactgcgccgtgccgtgcgtaaaagcggctccgactttagcagcccttttagcagcccgtcatgttctccgaggtgagtgacgtcgacctgacgttcaacctgggcgcgccgctgtcccatctggagcaggactggagcgacgcgccgcacgagcgtctgtcgctgagcgggcaccgcgtggtgtcggtgtgtctgggctccatcatggtgttcgggttcctcaacaacctgctggttctggttctgttctgccgcttccggtctctgcggactcccgtcaacatgctgctgctcaacatcagcgtcagcgacatgctggtgtgcgcgtgcggcacgacgctcagcttcgcctccagcctgcggagccgctggctgtacggccgcaccggctgcatgtggtacggcttcgtcaactcctgcttcggaattgtgtcactggtctccctggccgtcctgtcctacgaccgctacagcaccctgatggtgtacaacaagcgggtgtcggactacaggaagccgctgctggcggtgggcgcggcgtggctgtactcagtgggctggacggtgccccccctgctgggctggagcagctacggtctggagggggcggggaccagctgctcggtgacgtggacggagaggtcgtccgcctctcactcgtacatcgtctgtctgttcgtcttctgtcttggcctccccgtcctcgtcatggtgtactgctacggacgcctgctgcacgccgtcaaacaggtgggtcatatcaggcgcacggcagctcgtcgcagagagttccacatcctgttcatgatcgtcaccacggtggtgtgttacctgctctgctggatgccgtatggtgtcgtcgccatgatggccaccttcggccggcaaggagtcgtcagccccgtcgccgccgttgtcccatcgatcctcgccaagagcagcaccgtcattaaccccgtcatctacatcctcatgaacaaacagttctaccgctgcttcctgatcctgctcggctgtaaacacccgctgacggagagcgctcacttcgccgtgccctcaaagaccaccgtggtccagctcaaccgccgaccgtgtgacagcagctccagacacgccaccgccgctgagccggcgccgctcaccacacagggcagcatccacatggagggaaccagcgccgtcaaaacagaccccgccaaaccatctgaccccgcctccactgtgatgtaagcgcgatgtcaccctgtgagtcagcgatgaaaacacgttaacatccacaatatgaacacactgacgtgtgcggacatgtggacacgtatgtaaacatgtgccacagacatgtttacatttattaacatgaacacaacaacaaacaataaataaaacattaaaatcatcctgatgtttaaacataagaataaatgcttcgctattaacgaaggcattttcagagagtccgtcctcatcaacgtgatcgctacagagcgcaccagggcaatatcctcagatttggcacaaacatccacgcggacgcaacaatgaataaatcagaatttggtggtcgaaggtcattgtgaccttgcatctgtttcatttttgtgagtgcaatatctcaagaaggccttgaggtaagttccttaaattttgacaagaacgtccacttggactaaatgataaactgattagaatttggtggtcaaaggtcaaggtcatccatcttgttcttttgggtgccatatctcaagagggccttgaatttcttcagatttggcaccaacggccatcttgactcaacgataaactaattagaagttagaggttgaaggtcactgtgaccttgtccatctcattcttgtaaatgtgatatctcaagaaggccttgaggtgagttcctgaaatttggcacaaacattcatttggactcaacaataaactgataagaatttggtggtcaaaggtcaaggtaactgacctcacaaaacttcctaactcaacccttcatatcctgatcacacgtcaccgcagccgagagctggacatctctgtaactgattgattgattgattgattgattgattgactgaataaaatgtgaatatttttctatgctctctggtccgtctgttgctgtaaaaatgttctgttgagttgaataaataaatttgtgtgatgctctccg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]