GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 13:22:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_033045226            3700 bp    mRNA    linear   VRT 02-APR-2021
DEFINITION  PREDICTED: Amblyraja radiata protein argonaute-3 (LOC116988484),
            transcript variant X3, mRNA.
ACCESSION   XM_033045226
VERSION     XM_033045226.1
DBLINK      BioProject: PRJNA610638
KEYWORDS    RefSeq.
SOURCE      Amblyraja radiata (thorny skate)
  ORGANISM  Amblyraja radiata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes;
            Elasmobranchii; Batoidea; Rajiformes; Rajidae; Amblyraja.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045982.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Amblyraja radiata Updated Annotation
                                           Release 100.20210331
            Annotation Version          :: 100.20210331
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3700
                     /organism="Amblyraja radiata"
                     /mol_type="mRNA"
                     /isolate="CabotCenter1"
                     /db_xref="taxon:386614"
                     /chromosome="27"
                     /sex="male"
                     /tissue_type="testis, liver"
                     /country="USA: Gulf of Main"
                     /lat_lon="43.1336 N 68.3266 W"
                     /collection_date="2017-09-18"
                     /collected_by="Jeff Kneebone"
     gene            1..3700
                     /gene="LOC116988484"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 7 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116988484"
     CDS             63..2621
                     /gene="LOC116988484"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X3"
                     /protein_id="XP_032901117.1"
                     /db_xref="GeneID:116988484"
                     /translation="
MGKPIKLLANCFQVDIPKIDVYLYEVDIKPDKCPRRVNREVVDSMVQHFKVQIFGERRPVYDGKKSLYTADPIPVSTTGVDLEVTLPGEGKDRIFRVSIKFVSRVSWHLLHEVLTGRSMPELLPGLDLDKPLSTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKDKLLTGLKVEVTHCGPMRRKYRVCNVTRRPASHQTFPLQLENGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISKLVKNANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRVEPSHFRLQTNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFAAQRQCREEVLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLVIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYCELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADKNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFSADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHISGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    204..494
                     /gene="LOC116988484"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    522..674
                     /gene="LOC116988484"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    675..1052
                     /gene="LOC116988484"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(846..848,891..893,933..935,945..947,999..1001,
                     1020..1022,1026..1028)
                     /gene="LOC116988484"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1185..2492
                     /gene="LOC116988484"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1626..1628,1638..1640,1674..1685,1692..1694,
                     1716..1718,1725..1727,1737..1739,1749..1751)
                     /gene="LOC116988484"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1830..1832,1836..1838,2046..2048,2460..2462)
                     /gene="LOC116988484"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ccccaggagctgttggggctcagcccctcttcacggtgccaaggcgtccaggatgtggcaccatgggaaaaccgattaaactgctggccaactgcttccaagtagatatcccaaagattgacgtctacctctatgaggtagatattaaaccagataaatgtcctcgcagggttaacagggaagtggttgactctatggttcagcattttaaagttcaaatatttggagaaagaagacctgtctacgatgggaaaaagagtctctatactgctgatcccattccagtcagcaccacgggggtggatttggaggtgacgttaccaggagaagggaaagaccggattttcagggtctcaataaaatttgtttcaagagtgagttggcacttgctacatgaagttcttacaggacggagtatgccggagttgctgcccgggttggatctggacaagcctctcagcacaaatcctgtccatgcagttgatgttgttcttcgacatctcccctccatgaagtacacccctgttggccgctctttcttctctgcccccgaagggtatgaccatccattgggtgggggtagagaagtctggtttggttttcatcagtctgtcagaccagccatgtggaaaatgatgctgaacatagatgtttctgccactgctttctataaagcacagccagtaattcagttcatgtgtgaagttctagacatacataatattgatgaacaaccacgacctttgactgattcccatcgcgtcaaattcaccaaagagataaaagacaaacttctcacaggattgaaagttgaagtaactcactgtggacctatgaggagaaagtaccgtgtgtgcaacgtcaccagacgaccagccagtcatcaaacgttccccttacagctggaaaatggacagactgtggaatgcactgtggcgcaatatttcaaacagaaatacaaccttcagttaaaatacccacacctaccctgtctgcaggtgggacaggagcagaaacacacctatctgccactggaggtctgtaacattgtggcgggacagcgttgtatcaagaaactgacggacaatcagacatcaacaatgatcaaagcaacagcacgctcagcacctgatagacaagaggaaataagtaaattggtaaaaaatgcaaactatgacgctgatccttttgtccaggagtttcagtttaaagttcgagatgaaatggctcatgtgactggccgagtacttccagcccccatgctgcagtatggggggagggtggaaccaagtcattttagattacaaactaatcgtacagttgctactccaagtcatggtgtttgggacatgcgggggaaacagtttcatactggggttgaaatcaaaatgtgggcaatagcatgttttgcagcacagagacaatgtagagaagaagtacttaagagtttcactgaccagctacggaaaatatctaaagacgccggaatgccaattcagggccagccatgtttttgtaaatacgcacaaggagctgatagtgtggagccaatgttcaggcatctgaagaatacgtattcaggcctacaacttgttattgttattttacctgggaaaacacctgtctatgctgaagtgaagcgtgtgggagatactctactagggatggccactcagtgtgttcaggtgaagaatgttgttaaaacatctccacagacgttatcaaacctctgcctgaagattaatgtgaaattaggtggaatcaacaacattttggtaccacatcaacgaccatccgtgttccagcaacctgtgatttttctgggagctgatgttacacatccaccagctggagatggcaagaaaccctcaatcgctgctgttgtaggcagtatggatgcccatcctagtcgttactgtgccactgtgcgtgtacagagaccacgacaggagatcattcaagatttagcatctatggttcgagaacttctcatacagttttacaaatcaacgcgttttaagccgacccgaattatattttatcgtgatggagtttctgaagggcagtttcgtcaggttttgtattgcgagcttttggcgattcgagaagcatgcattagcctggagaaagactatcaacctggtattacatatatagtggtgcagaaacggcatcatacacgattattctgtgctgataagaatgaaagggttgggagaagtggaaatattccagcaggaaccacggtagatacagatatcacccacccatatgaatttgatttttatctctgcagccacgctgggatacaggggacaagtcgcccttctcactatcatgttctgtgggatgacaactgcttctctgcggatgagcttcagcttcttacctatcaactgtgtcacacgtatgtgcgttgcacacgctctgtatctatcccagcaccagcgtattatgcacatctagtggcatttagagcaaggtaccatttggtggacaaagagcatgacagtgctgaaggcagtcacatttctggtcagagtaatggacgtgaccctcaggctcttgccaaggctgtgcagattcaccaggacacattgcgcactatgtacttcgcttaagtttgggaaattctctccagaaggaaccgaaaatcacagcctgcaattccagtggggtcagtttacgggcatgtctccagccatactgtaactttcactgtgtggggacaataatttcataaactgacgaaaagagattgtttacctacgaagatcatagcactattatgcaatatgaaaccagccaactgctctgtgtgtgtgtgtgtgtgtgtgtgtgtatgtatgcgcgtgtgggtgtgtgcatgtgcgtgcgtgctccgtcagacctcgtgtctgtctttcctttttttttctccagtatagtttcctttttgcctttacctcagtgtttggcagcacaaacgtcatgcaacatgaaaatgggacaaagaaaaatgtttgacaaaacttggatctcaaaacaagtcactaattagttcaaaggtccaatcatttgcttggagtcttcaacttggaagggtgggtggttggagaaggaggtgaagacttgcttgaaaaaaaatattctagggaataactaccaatgctttataagatccaaaagtccacctccaccaggccacttttcaaattctgcatactcatcaattagtgagttaaatcaacagattattgaactcggctactagttatggttgagcaccataaacagtgcagtggaattttgtatagaagataatatccatgtcttggataacccttaattattgacgatataagatcttttgaaaattccaagaaatggggctatgtttaatgtagaaacttctgctttttgttactgtttacttgctaactcacaacaaaatgtgatgttttctgttttagcatcctatatttattagaaaaaataatgcttaatttaatatggatttacattaaagtatagtagcatcaattctatttagttctggaatgtaaccgtgttgtatactgacagaacattgctaccgttagtgcaataagcggttggtaagaaagcccgtgtcctacgctgttctggagcagcagttgtaccactataatcgtgggagagtggacacctccgcacttcagaaccttatcagttttaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]