2025-10-15 00:15:04, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_029513747 2592 bp mRNA linear VRT 15-JUL-2025 DEFINITION PREDICTED: Echeneis naucrates argonaute RISC component 4 (ago4), transcript variant X7, mRNA. ACCESSION XM_029513747 VERSION XM_029513747.1 DBLINK BioProject: PRJNA548465 KEYWORDS RefSeq. SOURCE Echeneis naucrates (live sharksucker) ORGANISM Echeneis naucrates Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Carangiformes; Echeneidae; Echeneis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_042521.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_900963305.1-RS_2025_07 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 07/15/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2592 /organism="Echeneis naucrates" /mol_type="mRNA" /db_xref="taxon:173247" /chromosome="11" gene 1..2592 /gene="ago4" /note="argonaute RISC component 4; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 9 Proteins, and 94% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:115050728" CDS 1..2592 /gene="ago4" /codon_start=1 /product="protein argonaute-4 isoform X7" /protein_id="XP_029369607.1" /db_xref="GeneID:115050728" /translation="
MEALGPGPPAPTSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDMSQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHYDTQHTMYFA"
misc_feature 82..471 /gene="ago4" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 502..654 /gene="ago4" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 655..1017 /gene="ago4" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(811..813,856..858,898..900,910..912,964..966, 985..987,991..993) /gene="ago4" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1156..2463 /gene="ago4" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1567..1569,1579..1581,1615..1626,1633..1635, 1657..1659,1666..1668,1678..1680,1690..1692) /gene="ago4" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1771..1773,1777..1779,2017..2019,2431..2433) /gene="ago4" /note="active site" /db_xref="CDD:240015" ORIGIN
atggaagcgctcggacccggcccgcctgcccctacctctctgtttcagcctccgcggcgtcccggcctcggcacggtggggaaacccatccggctccttgccaaccacttccaggtgcagattcccaagattgatgtttatcattatgatattgacatcaagcctgagaaacggcctcgaagggtcaacagggaggtggtggacaccatggtgcggcacttcaagatgcagatctttggagaccgacagcctggctacgacgggaagaggaacatgtacacagcacatccactgccaatagggagggacagggtggatttggaggtgaccctgcctggtgaggggaaggatcagacattcaaggtgtccttgcagtgggtgtctgtggtcagtcttcaaatgctgctggaagccctgtccggtcacctgaacgaggtccccgaagactctgtccaggccctggatgtcatcacccggcacctaccctccatgaggtacactccagtggggcgttcatttttctccccgccggagggctactatcatcctctgggtggaggcagggaggtctggtttggtttccatcagtctgtccgtcctgccatgtggaacatgatgctcaatatagatgtgtcggccactgctttctaccgtgcccagcctgtgatagaattcatgtgcgaagtgcttgatatccagaacatcaacgaacagaccaaaccactgacggactcgcagcgcgtcaaattcaccaaggaaataagaggattgaaagttgaggtcacacattgtggtcagatgaagagaaaatatcgagtgtgcaatgtcacacgccgacctgccagccaccaaacgttccccttacagcttgagaatggccaagccatggagtgcacagtagcccagtatttcaagcagaagtacaacctgcagctcaagtatcctcatttgccttgtctacaagtggggcaggaacagaaacacacctaccttcccctggaggtctgtaacattgtagcaggccagcgctgtatcaagaaattgacagacaaccagacatccaccatgattaaagctacagctcgctcagcccccgacagacaagaagagatcagccgactggtcaaaagcaacagcatggtcggggggccagacccttacctgaaggagtttggcattgtggtgcacaatgacatgacggaggttactgggcgtgtgctccctgcgcccatgctgcagtatgggggccggaataaaactgtggccacgcccaaccagggcgtgtgggacatgcgcgggaagcagttctatgctggcatcgagatcaaggtctgggctgtggcctgcttcgccccacagaaacagtgtcgggaagacctgctcaagagcttcactgaccagctgcgaaaaatttcaaaggatgctgggatgcccattcaaggccagccatgtttctgtaaatacgcccaaggagctgacagtgtggagccgatgtttaaacacctcaaaatgtcttatgtcgggctgcagctgattgtggtcattctgcccggcaaaacacctgtctatgccgaggtgaagagggtgggcgacactctcctcggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagactctctccaacctctgcctcaagatcaacgccaaactgggaggcatcaacaacgttcttgtgcctcatcagaggccctctgtgttccagcagccagtcatctttttgggggccgatgtgacgcatcctcctgcaggtgacgggaagaagccatccattgcggcagtggtgggcagcatggatggccaccccagcagatactgcgcaacagtgcgagtccagacatcacgacaagacatgtcccaggagcagctcttcagccaagaggtcatccaagacttgaccaacatggtgcgggaactgctcatccagttctataagtccacacgcttcaagcccactcgtatcatctattaccgcggcggcgtgtcagagggacagatgaagcaggtggcatggccagagctgatagcaatccgcaaggcgtgcatcagtctggaggaggattacaggccgggcattacctacattgtggtccagaagcgtcaccacactcgtctattctgctctgacaaagctgagcgggtggggaagagtggcaatgtcccagccggcaccacagtggacagtaccatcacacacccgtccgagttcgatttctacctgtgcagccatgctggtattcagggaaccagtcgtccctcccactaccacgtcctgtgggatgacaactgcttcacagcagatgaactgcagctcctcacctaccagctgtgccacacctacgtccgctgcactcgctccgtctccatcccagcaccggcctactacgccaggctagtggccttccgagcccgataccacctggtggacaaagaccacgacagcgctgaaggcagccacgtgtcgggacagagtaatggccgggaccctcaggcactggccaaggcagttcagatccactatgatacccagcacaccatgtacttcgcctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]