2025-07-03 09:02:21, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_028744516 2344 bp mRNA linear VRT 21-APR-2019 DEFINITION PREDICTED: Podarcis muralis pre-mRNA-splicing factor cwc25-like (LOC114604422), transcript variant X1, mRNA. ACCESSION XM_028744516 VERSION XM_028744516.1 DBLINK BioProject: PRJNA529705 KEYWORDS RefSeq. SOURCE Podarcis muralis (Common wall lizard) ORGANISM Podarcis muralis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Laterata; Lacertibaenia; Lacertidae; Podarcis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_041320.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Podarcis muralis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2344 /organism="Podarcis muralis" /mol_type="mRNA" /db_xref="taxon:64176" /chromosome="9" /sex="male" /tissue_type="muscle" /dev_stage="adult" /ecotype="yellow" gene 1..2344 /gene="LOC114604422" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 8 samples with support for all annotated introns" /db_xref="GeneID:114604422" CDS 107..1972 /gene="LOC114604422" /codon_start=1 /product="pre-mRNA-splicing factor cwc25-like isoform X1" /protein_id="XP_028600349.1" /db_xref="GeneID:114604422" /translation="
MFKYDGLESARGQYSHFKKCDELRQRYPDWNPEEFSLLQRHEGDKKEKHIPMPCSTSSNPNTSQHSIPGHASSQTRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSHRHRSRSSERRSSPSSSSQTSASQKRELRKSTRSPASSAEAGSSRKPPAKSDAAEQPPKKSEHPLQTNPGHQEPPKKEVAMREQGDQQLPSKSDVAKQPPNKSDQPLLTNPGHQELPKKEAATQEQADRQPPAKSDVAEQPPKKSEHPLQTNLDHQELPKMEAATQGQGDRQREDHMRFSLTPFVEQSVMQALSLLQPGGTVGAGLTQGTSLPPLPALQIEAASLSLVSMMQLVATQVLQAALSVQESPSVAGPSPQLSIPAGSEEKKQESSQEVVPGVVPPCSGYPVINIWIVGHYITHWAFVRATSTCLGSCLGLPESFSVSWVTKCDMKWEEFMPIVMARAAFHGPPKALIVQLGDNDLGLRSGKDLAVSMIKDFDKLAALFPGLTLIWSEMLVRRHWQDFPSPRGINKTRKTINRRVAEKVQLLNGQVIRHPNITYRQEDLFHNDGVHLSDLGSDVWLADLVKGIKDWLQV"
misc_feature <617..>1024 /gene="LOC114604422" /note="104 kDa microneme/rhoptry antigen; Provisional; Region: PTZ00449" /db_xref="CDD:185628" misc_feature <1568..1954 /gene="LOC114604422" /note="Lysophospholipase L1 or related esterase. Includes spore coat protein LipC/YcsK [Cell cycle control, cell division, chromosome partitioning, Lipid transport and metabolism]; Region: TesA; COG2755" /db_xref="CDD:442045" ORIGIN
cgtttatgcctccgtcttcagaatctccatctccgtcaatgatgaatgattatcatgctgtgtcgccaacagtacttccacacatgtgttctctgtgtaaaatagaatgttcaagtatgatgggctggaatctgcacgtgggcagtattcacacttcaagaaatgtgatgagctacgccaacggtatcctgactggaatccagaagaattttctttgttacagagacatgaaggcgacaagaaggaaaaacatattccaatgccatgctctaccagttctaacccaaacacttcacagcactcaattcctggccatgcctcaagtcagactcggtcacgatctaggagccctggaccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccacagacataggtccaggtcttcagagcgacgaagctcccccagctcaagttctcaaacctcggctagccagaaaagagaactgagaaaatcaactagatctccagcatcgtctgcagaagcaggaagctccaggaaacctccagccaaatctgatgcggcagaacaaccacccaagaagtcggagcatccactgcagacaaatcctggccaccaggagccgcccaagaaggaggtcgcaatgcgggaacaaggagaccagcaacttccatccaaatctgatgtggcaaaacaaccacccaacaagtctgaccagccactactgacaaatcccggccatcaggagctgcccaagaaggaggcagcaacgcaggaacaagcagaccggcaacctccagccaaatctgatgtggcagaacaaccacccaagaagtcggagcatccactgcagacaaatctcgaccatcaggagctgcccaagatggaggcagcaacacagggacaaggagaccgccaacgtgaagatcatatgcgcttttcattgacaccatttgtagaacaaagtgtcatgcaggccctgtcgctgctgcagcctggaggcacagtgggtgctggactcacccaaggaacaagcttgcccccacttcctgctttgcagatcgaggcagcatccctatcccttgtctccatgatgcagcttgttgcaacacaggtattgcaagctgccttaagtgtgcaggaaagcccaagtgtggctggcccaagcccccagttaagtattcctgcaggaagcgaagaaaagaagcaggagagcagtcaggaagtggtgccaggagtcgttcctccttgctcaggttaccccgtgattaacatatggatcgtgggacactatatcacccactgggcctttgtgcgtgccaccagtacctgcttgggtagctgcctggggcttcctgaaagtttcagtgtttcctgggtcacaaagtgtgacatgaaatgggaggagtttatgccaatcgtgatggccagagctgcctttcatggcccccccaaagctctgattgttcaacttggagacaacgacctgggtctaaggagcggcaaggacctagccgtaagcatgattaaggactttgataagctggctgctttgttcccaggcctgaccttaatctggtctgaaatgctggtgaggcggcattggcaagatttccccagcccgcggggaatcaacaagaccaggaagactattaatcgtagggtggcagagaaggtgcagctcttgaatggacaggtgatacgacaccccaacattacttacaggcaggaggacttgtttcataatgacggcgttcacctttccgatttgggaagtgatgtttggctggctgatctcgtcaagggcattaaggattggctgcaggtgtgagggtgttggcagcgatcctttggggcttgagtggcggttaggcattgggtaagtcttgtttatgggaggggagattgtagcctccacctgcccctcctcgttaagggtatcctgttaaagggatctgggtgtgtggtgcctgtccaaagcctgggcgtgggctagggccatgccacaaccccttcagggaccctgggggtgccacgatttgatgtatatcatagggctccctctaccggtggtttattcttaggagggtccctgcagatgggcaggagtcatgatatagtcttctttcacccaatgcctaagacaaaccgctcacgtgtgtaaccaataaagttgtggcccattttatcccattgacctaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]