2024-04-27 02:46:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_026782069 2504 bp mRNA linear ROD 15-OCT-2018 DEFINITION PREDICTED: Microtus ochrogaster argonaute 4, RISC catalytic component (Ago4), transcript variant X2, mRNA. ACCESSION XM_026782069 VERSION XM_026782069.1 DBLINK BioProject: PRJNA210839 KEYWORDS RefSeq. SOURCE Microtus ochrogaster (prairie vole) ORGANISM Microtus ochrogaster Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Cricetidae; Arvicolinae; Microtus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_022016.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Microtus ochrogaster Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2504 /organism="Microtus ochrogaster" /mol_type="mRNA" /isolate="Prairie Vole_2" /db_xref="taxon:79684" /chromosome="10" /sex="female" gene 1..2504 /gene="Ago4" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:101993046" CDS 38..2227 /gene="Ago4" /codon_start=1 /product="protein argonaute-4 isoform X2" /protein_id="XP_026637870.1" /db_xref="GeneID:101993046" /translation="
MEALGPGPPASLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDVDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQLLLEALAGHLNEVPDDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQEIAQELLYSQEVVQDLTSMARELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERAHIC"
misc_feature 80..2191 /gene="Ago4" /note="protein argonaute; Provisional; Region: PLN03202" /db_xref="CDD:215631" misc_feature 1187..>2212 /gene="Ago4" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1598..1600,1610..1612,1646..1657,1664..1666, 1688..1690,1697..1699,1709..1711,1721..1723) /gene="Ago4" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" ORIGIN
cgccggggaccggagcgaggcggcccccgtcgccgccatggaggcgctgggacccggacctccagccagccttttccagccacctcggcgtcctggccttggaactgttgggaagccaattcgactgttagccaatcattttcaggttcagatccctaaaatagatgtgtatcactatgatgtggatattaaaccagaaaaacggcctcgtagagtcaacagggaggtggtagacactatggtacgacacttcaagatgcagatatttggggatcggcagcctggttatgatggcaaaagaaacatgtacacagcacatccactgccaattggacgtgatagggttgacatggaggttaccctcccaggtgagggtaaagaccaaactttcaaagtgtctgtgcaatgggtgtcagttgtgagccttcagttgctcttagaagctttagctgggcacctaaatgaagtcccggatgattcagtacaagcacttgatgttattacaaggcatcttccctctatgaggtacactccggtgggccgttcttttttctcaccccctgaaggttattaccaccctctgggaggtggcagagaggtctggttcggctttcaccagtctgtgagacctgccatgtggaatatgatgctcaacattgatgtatctgcaactgctttttaccgggctcagcctatcattgagttcatgtgtgaggttttagacattcagaacatcaatgaacagacaaaacctctaacagactctcagcgtgtcaagtttaccaaagaaattagaggtctcaaagttgaggtgactcactgtggacagatgaaacgaaaataccgagtttgcaatgtgacaagacggccagccagtcatcaaacctttcctttgcagctagaaaatggtcaagctatggaatgtacagtagctcagtattttaagcagaagtatagtctgcaactgaaatacccccatcttccatgccttcaagtgggacaagagcaaaagcatacatacttgccacttgaggtctgtaatatagtggcaggacagagatgtataaagaagctcacagacaatcagacatccacaatgatcaaagccacagcgagatctgctcctgacagacaggaagaaatcagtagactggtgaagagcaatagcatggtgggtggacctgacccatacctgaaggaatttgggattgttgtccacaatgagatgacggagctcacaggcagggtgcttccagctccaatgctgcagtacggaggccggaataaaacagtagccacacccaaccagggtgtctgggacatgcgaggaaagcagttttatgctggcattgaaattaaagtttgggcagtggcttgttttgcgcctcagaaacaatgtagggaagatttactaaagagtttcaccgaccagcttcgtaaaatctccaaggatgcagggatgcccatccagggtcagccatgtttctgcaagtatgcacaaggtgcagacagtgtggagcccatgtttaaacacctgaaaatgacatatgtgggcctgcagctaatagtggttatcttgcctggaaagacaccagtatatgcggaggtgaaacgagttggagatacccttttaggtatggccacacaatgtgtccaggtcaaaaatgttgtcaagacctcaccccaaaccctttccaacctttgcctgaagataaatgcaaagcttggaggaattaacaatgtacttgtacctcatcaaaggccttcagtgttccagcagcctgtcatcttcctgggagcagatgtcactcatccacctgctggggatgggaagaagccttctattgcagccgtggtgggcagcatggacggccaccctagccgatactgtgccacagtgcgggtgcagacgtctcggcaggagattgcccaggagctgctctacagtcaggaggttgtgcaggacctgacgagcatggctcgggagctgctgattcaattctacaagtccacacgtttcaagcccactcgcatcatctactaccgcggaggggtgtcggagggacagatgaaacaggtagcttggccggagctaatagcaattcgaaaggcatgtataagcttggaggaagactatcgaccaggaataacctacattgtggtgcaaaagagacatcacacacgcctcttctgtgcagataaaacagaaagggcacacatttgctagacaccgaaggaggcagaaatgcctctgatgtgttccatgtgtgtgggaggcggatagacggcatggcagcagctgttactatgctcacatcctttcgagcactgctctagagccttccttgtggatccttttcatccgcacagcaacccgacgatggaagcacgggatcaccacatgctgcacaagagaaaaccgaggtacagagacgtgagatggtttgtccagtgttacagagctagtgaatggcagggcaaggattgaaacccagacagctcta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]