2024-04-25 15:21:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_026300046 3166 bp mRNA linear VRT 10-APR-2020 DEFINITION PREDICTED: Mastacembelus armatus protein argonaute-3-like (LOC113126172), transcript variant X1, mRNA. ACCESSION XM_026300046 VERSION XM_026300046.1 DBLINK BioProject: PRJNA489256 KEYWORDS RefSeq. SOURCE Mastacembelus armatus (zig-zag eel) ORGANISM Mastacembelus armatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Anabantaria; Synbranchiformes; Mastacembelidae; Mastacembelus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_046643.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Mastacembelus armatus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3166 /organism="Mastacembelus armatus" /mol_type="mRNA" /db_xref="taxon:205130" /chromosome="11" gene 1..3166 /gene="LOC113126172" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 18 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:113126172" CDS 379..2982 /gene="LOC113126172" /codon_start=1 /product="protein argonaute-3-like isoform X1" /protein_id="XP_026155831.1" /db_xref="GeneID:113126172" /translation="
MEIGTTGAVGAQALFSLPRRPGYGSIGKPIKLLANCFQVEIPKIDIYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRMPVYDGKKSLYTANALPVATGGVDLDVTLPGEGGKDRPFKVTIRFVSLVSWHMLHEVLTGGSVPKTLDLEKPLSTNPVHAVDVVLRHLPSMKYTPVGRSFFSSPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLSDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASLQTFPLQLENGQTVERTVAQYFREKYSLHLKYPHMPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYEADPFVQEFQFRVRDEMAQVTGRVLPAPMLQYGGRVSSEPFMNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREDILKIFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRYKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKEYQPGITYIVVQKRHHTRLFCADRNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADEFQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQVLAKAVQIHHDTLRTMYFA"
misc_feature 595..879 /gene="LOC113126172" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 907..1059 /gene="LOC113126172" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 1060..1422 /gene="LOC113126172" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1216..1218,1261..1263,1303..1305,1315..1317, 1369..1371,1390..1392,1396..1398) /gene="LOC113126172" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1555..2853 /gene="LOC113126172" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1987..1989,1999..2001,2035..2046,2053..2055, 2077..2079,2086..2088,2098..2100,2110..2112) /gene="LOC113126172" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2191..2193,2197..2199,2407..2409,2821..2823) /gene="LOC113126172" /note="active site" /db_xref="CDD:240015" ORIGIN
gagggcggtgcaggagccgacttcagaccggtttctctccgagatcgagcaggactctggggtagcgaagtgagtttgatacagagaaacaccgggttgtcacgttaattcacccgggaagacgaactcgatcaccgaccagtgcaagcgaaaacagtttaaacgacagagccgggaacattttgttgaacttggagctgtcagtttccgtcagagaaggggactttcagccgaggggactcccaagcggcccggttccacatcagcgaccggagccgggaagcggcgtgtcggccagcgggtctgcagtcagagccttaaactacgccgggagaactgatcactgggtgccggggcatccggacagagaccccatgaatggaaatcggaacaacaggagccgttggagcccaagccctgttttcattgccaaggcgacccggctatggcagcatcgggaagcccatcaagcttttggccaactgcttccaggtggaaatccccaagattgacatctatttatatgaggtggacatcaaacctgataaatgtcctcgcagagtcaacagggaggtggtggattccatggttcagcatttcaaggtgaccatctttggtgatcgtatgccagtttatgatgggaagaaaagcctctacactgcaaatgcacttcctgttgccactggtggggtcgatttggatgtcaccctgccaggtgaaggtgggaaggatcgcccatttaaagtcaccattagatttgtgtcattggtcagctggcatatgctacacgaagtcttgacgggaggcagtgtacccaaaacgctggacctggagaagcctctcagcactaaccctgttcacgctgtggatgttgttcttcgacacctgccctccatgaagtacactcccgttggacgatccttcttctcttcccctgagggctacgatcatccactaggtggaggacgagaagtttggtttggtttccatcagtcagtacggccagccatgtggaaaatgatgctcaacattgatgtgtcagccacagccttttataaagcccagccagtcatccagttcatgtgtgaagtccttgacattcacaacattgatgagcagccccgtcctctctctgactcccacagggtcaagtttaccaaagagatcaaaggtcttaaagtggaagtgacacactgtggaactatgcgtaggaagtacagagtttgcaacgtaacacgacgccctgccagcctgcagacatttccattgcagcttgagaatggtcagactgttgaacgcacagtggcgcagtactttagagagaaatacagtctgcatctgaaatacccccacatgccctgtctgcaggtgggccaggagcagaaacacacctacctgccactggaggtttgcaacattgtagcgggacagcgctgtattaaaaaactaacagacaaccagacatcaaccatgatcaaagcaacagcccgctcggcaccagacagacaggaagagatcagcaggctggtgcgcagtgcgaattatgaggccgacccgttcgttcaggagttccagttccgcgtacgtgatgagatggctcaggtgacaggccgcgtcctgccggcccccatgctgcagtatggcggcagggtgagctctgaaccctttatgaaccgcacggtggccacacccagccatggggtgtgggacatgagggggaagcagttccacaccggagtggagatcaaaatgtgggccatcgcctgctttgccacccagaggcagtgccgagaagatatcctcaaaatcttcactgaccagctgcggaaaatctcaaaggatgctgggatgcccattcagggccagccgtgcttctgtaaatatgcccagggagctgacagtgtggagcccatgttcagacacctgaagaacacctacgccgggctgcagctcatcatcgtgatcttgcctggcaaaacacctgtctatgctgaggtgaagcgggtgggagacaccctcctgggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagaccctctccaacctctgcctcaagatcaacgtcaaactagggggcatcaacaatatcctggttccacaccaacgaccctctgtcttccagcagcctgtcatctttcttggggcagatgtcactcatcctccagcaggagatgggaaaaagccatctattgcagcggtggtgggcagtatggatgcccaccccagcaggtattgtgctacagtgcgtgtccagaggcccagacaggagatcatccaggatttggcctctatggttcgagagcttctgatccagttctacaaatcaacccgctacaaaccaaccaggattatcttctacagggacggagtgtcagagggccagttcagacaggtgctgtactatgagctgctggcaatcagagaagcctgcatcagtctagagaaagaatatcagccagggattacctacatcgtcgtgcaaaaacgccatcacacgcgcctcttctgtgccgatcgtaatgagcgggttggacgaagtggaaacattcctgctggcaccacagtggacacagacatcacccacccctatgagtttgacttttacctctgcagtcacgctggaatccaaggtacaagtcgtccctcccactaccatgttttgtgggacgacaactgttttacagctgatgagttccagctcctcacataccagctgtgccacacctacgtccgctgcacacgctcggtctccatcccagcaccagcctactacgcccacttggtggccttccgcgcccgctaccacctggttgacaaagagcatgacagtgcggagggcagccatgtctcagggcagagtaatggcagggaccctcaggtgctggccaaggctgttcagatccaccatgacacactgaggaccatgtacttcgcctgaaaagccacatccacatccctcagccagtgtctgacttctatcagccacctcatcccatcagccccatgctggtgcaccttggtgtaaggatgtaacaaaccagataggatttacactcacattatgcaatttgaagccagccggttgtttgcgtactgctgcccatgcatcactttcttctcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]