LOCUS       XM_025181222            2965 bp    mRNA    linear   VRT 04-JUN-2018
DEFINITION  PREDICTED: Pelodiscus sinensis argonaute 3, RISC catalytic
            component (AGO3), transcript variant X2, mRNA.
ACCESSION   XM_025181222
VERSION     XM_025181222.1
DBLINK      BioProject: PRJNA221645
KEYWORDS    RefSeq.
SOURCE      Pelodiscus sinensis (Chinese soft-shelled turtle)
  ORGANISM  Pelodiscus sinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Trionychia;
            Trionychidae; Pelodiscus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005851450.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pelodiscus sinensis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2965
                     /organism="Pelodiscus sinensis"
                     /mol_type="mRNA"
                     /isolate="Daiwa-1"
                     /db_xref="taxon:13735"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="Japan: Saga"
     gene            1..2965
                     /gene="AGO3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 48 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:102448842"
     CDS             72..2504
                     /gene="AGO3"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X2"
                     /protein_id="XP_025037007.1"
                     /db_xref="GeneID:102448842"
                     /translation="

MVPRRPGYGTMGKPIKLLANCFQVEIPKIDVYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDR"

     misc_feature    243..527
                     /gene="AGO3"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    555..707
                     /gene="AGO3"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    708..1070
                     /gene="AGO3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(864..866,909..911,951..953,963..965,1017..1019,
                     1038..1040,1044..1046)
                     /gene="AGO3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1203..2480
                     /gene="AGO3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1614..1616,1626..1628,1662..1673,1680..1682,
                     1704..1706,1713..1715,1725..1727,1737..1739)
                     /gene="AGO3"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1818..1820,1824..1826,2034..2036,2448..2450)
                     /gene="AGO3"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

ttaaccattatgtttcgcttctaaattgtattgtttcctttacaggacccgtcggggcacagccccttcttatggtgcccagacgtcccggctatggcaccatgggcaaacctattaaattgctggccaactgcttccaagttgaaatcccaaagattgatgtctacctctatgaggtggatattaaaccagataagtgtcctcggagggtgaacagggaggtggtggactccatggtgcaacattttaaagtgacaatatttggggaccgtagaccagtttatgatgggaagagaagcctttatactgccaatccgctccctgtagcaaccactggggtagatttggatgtaacattaccaggagaaggtggaaaagatcgtcccttcaaggtgtcaataaagtttgtttctcgggtgagctggcacttgctgcatgaagttttgacaggaagaaccttgcctgagcctctggaattagacaaaccaatcagcactaaccctgttcatgctgttgatgtggtgctacgacacctgccctccatgaagtataccccagtgggccgatcctttttctctgctccagagggctatgatcaccctttgggagggggcagagaagtatggtttgggttccatcagtctgttcggcctgccatgtggaaaatgatgcttaatattgacgtttctgccactgccttctacaaagcacaacctgtaattcaattcatgtgtgaagttctcgacattcataacattgatgaacaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaagggtctcaaggttgaagtgactcactgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggagacctgccagtcatcaaaccttccctttacagttagaaaatggccaaacagttgagagaacggtagcacagtacttcagagagaagtataacctccagctgaaatatcctcatctaccttgtctacaagtgggacaggagcagaaacatacttacctgcctctagaagtatgtaacattgtggccggtcagcgatgtatcaagaagctaacggacaatcagacatcaactatgataaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgatgcagatccatttgttcaagagtttcagtttaaagtacgggatgagatggctcatgtgacaggacgtgtacttccagctccaatgttgcagtatggaggacggaatcgaacagtggcaaccccaagccatggtgtctgggatatgcgagggaaacagtttcacactggtgttgagatcaaaatgtgggccatagcttgctttgcaacacagagacaatgcagagaagaaatactgaagggatttacagatcagctacgcaagatttcaaaggatgcagggatgccaatccaaggccagccatgtttttgcaaatatgcacagggtgcggatagcgtggagccgatgttccgacacctgaaaaacacctattcagggctccaactcatcatcgtcatcctgccaggaaaaacacctgtgtacgcggaggtgaaacgtgtgggagatacgctgttggggatggccacacagtgcgttcaagtcaagaatgtcataaaaacatctcctcagactctctcaaacctgtgcctaaagattaatgttaaattaggaggaatcaacaacattcttgtacctcatcaacgaccttctgtgttccaacaaccagtgatcttcttgggagcagatgttactcatccacccgctggggatggaaagaagccttccattgctgctgttgtaggtagtatggatgctcatccaagcaggtattgtgccacagtgagagttcaaagacctcggcaggagattatccaagatttggcctccatggtaagagaacttctcatccagttctacaagtcaacgcgattcaaacccacgcgcatcattttctacagggatggggtttctgaaggacagtttcgacaggtgttgtattatgagctgctagcaattagagaggcctgcatcagtctggagaaagattaccagccaggaataacatacatcgtcgtgcagaaacgacatcacacacgtttgttctgtgcggacagaactgaacgggttggaagaagtggcaacattccagctggaacaactgtagatacagatattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccctctcactatcatgttttgtgggatgataactgttttactgcagatgaacttcagctgctgacttaccagctctgtcacacatatgtgcgttgcacacgatctgtttctatacctgcaccagcgtattatgctcacctggtagcattcagagcaagatatcatcttgtggataaagaacatgacaggtaaatgaaaatacaagtgtttagatttatgttctctttcagccctcagtccaaaaccttttccctattgtcaggctttaaactatctaattgtagtttagcagtccccaaatattttccctgcatgaactcattttcacatgtactccttcctgcaaccctagacatcctggcaaatgctgtttaaaaaaggcatcttccttgcagcatgacctcacacactctctctctattttgtattacaaagtggcattctatgcacagtgtgaccttgctcacatatggtgtgagatcacattgcatagagcaggcgctagtctgcagaacagcaaagtgtcctccaggcagcatgacatcacatgtactatgtatatgatatcatgttgttcgaaagataccattttgccagaggtgtagccatgttaaactgtaacttttaaaaatgagtagccctttggtaccttc

//