GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-12-08 04:08:15, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_022886064             732 bp    mRNA    linear   PLN 25-OCT-2017
DEFINITION  PREDICTED: Durio zibethinus uncharacterized LOC111293270
            (LOC111293270), mRNA.
ACCESSION   XM_022886064
VERSION     XM_022886064.1
DBLINK      BioProject: PRJNA407962
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Durio zibethinus
  ORGANISM  Durio zibethinus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Malvales; Malvaceae; Helicteroideae;
            Durio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019168470.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Durio zibethinus Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 24% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..732
                     /organism="Durio zibethinus"
                     /mol_type="mRNA"
                     /cultivar="Musang King"
                     /isolate="D1"
                     /db_xref="taxon:66656"
                     /chromosome="Unknown"
                     /tissue_type="Fruit stalk"
                     /dev_stage="Mature"
                     /geo_loc_name="Malaysia: Pahang"
     gene            1..732
                     /gene="LOC111293270"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 75% coverage of the
                     annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:111293270"
     CDS             1..732
                     /gene="LOC111293270"
                     /codon_start=1
                     /product="uncharacterized protein LOC111293270"
                     /protein_id="XP_022741799.1"
                     /db_xref="GeneID:111293270"
                     /translation="
MDSFDFDNVKAEKVKAMRKYNRLRSLAEVFRFLELLLALLFLAWTFERVPLAVKISGEFFLKLGSVIASPLFVFFVCNVIIVTLIAKSGIFSAINNADSKLYEEMIKNAENRSKSGSQEEIVYQDKEIISEVNTCTSNCEEMEPESESESESESNSGAEVDNPRVYRRSKSEKLVIKKSEEVKKKLQRSETQNCQKIENIDEKLFPEDELSNEEFQRTIEDFIAKQLRFRRAESLSIVLQSQA"
ORIGIN      
atggattcgtttgatttcgataacgtgaaagcagagaaagttaaggcgatgaggaagtacaatcggcttcgaagcttagccgaggtgtttcgttttttggaattgcttttggctttgctgtttttagcatggaccttcgagcgcgtgcctctcgccgtcaaaatctccggcgagttctttttgaaactcggcagcgtcatcgcgagtccgctctttgttttcttcgtctgtaatgtcatcatcgttactctcattgctaagtccggcatcttttctgccattaacaatgccgattccaaactttacgaggaaatgatcaaaaacgctgagaatcgctccaaatcggggtctcaagaagagattgtgtatcaagacaaagagattatctctgaagtgaacacatgtactagcaattgcgaggaaatggagccggagtcagagtcagagtcagagtccgagtcgaactccggtgctgaggtagataaccccagagtgtataggaggagcaagtcagagaagttggtgataaaaaagagtgaggaagttaagaagaaactacaacgatcggagacccagaattgccaaaaaattgaaaatattgacgagaaattgtttccagaagacgaattgagcaatgaagagtttcaacgaacgatcgaagattttatcgccaaacagttgaggtttcgccgagcagagtctctgtctatcgttcttcaaagccaagcttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]