GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-01 05:20:41, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_022507366            1069 bp    mRNA    linear   MAM 20-SEP-2017
DEFINITION  PREDICTED: Enhydra lutris kenyoni copper chaperone for superoxide
            dismutase (LOC111150046), transcript variant X1, mRNA.
ACCESSION   XM_022507366
VERSION     XM_022507366.1
DBLINK      BioProject: PRJNA407952
KEYWORDS    RefSeq.
SOURCE      Enhydra lutris kenyoni (northern sea otter)
  ORGANISM  Enhydra lutris kenyoni
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Musteloidea; Mustelidae; Lutrinae; Enhydra.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019154106.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Enhydra lutris kenyoni Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1069
                     /organism="Enhydra lutris kenyoni"
                     /mol_type="mRNA"
                     /isolate="GAN:26980312"
                     /sub_species="kenyoni"
                     /db_xref="taxon:391180"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..1069
                     /gene="LOC111150046"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 2 ESTs, 9 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:111150046"
     CDS             75..899
                     /gene="LOC111150046"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase
                     isoform X1"
                     /protein_id="XP_022363074.1"
                     /db_xref="GeneID:111150046"
                     /translation="
MASDSGDRGTACTLEFTVQMTCQSCVDAVRTSLQGVAGVQNVEVQLENQMVLVQTTLPSQEVQALLEGTGRQAVLKGMGSGLLQNLGAAVAILEGPGPVQGVVRFLQLTSERCLIEGTIDGLEPGLHGLHVHQFGDLTGSCDSCGDHFNPDGASHGGPQDSDRHRGDLGNVHADADGRASFRIEDEQLKVWDVIGRSLVIDEREDDLGRGDHPLSKVTGNSGERLACGIIARSAGLFQNPKQICSCDGLTIWEERGRPIAGEGRKEPAKPPAHL"
     misc_feature    114..833
                     /gene="LOC111150046"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      
cccgcgacgccgttaaggttttgcacctgagcggcggagtagtttaggtcttacggccggtggctgggtccgggatggcttcggactccggggaccgcgggaccgcctgcacgttggagttcacagtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaaggggtggcaggtgtccagaacgtggaagtgcagttggagaaccagatggttctggtgcagaccacgttgcccagccaagaggtgcaggcccttctggaaggcacagggcggcaggcggtgctcaagggcatggggagtggcctgttgcagaacctgggggcagcagttgccattctggagggccctggtcctgtgcaaggggtggtgcgcttcctgcagctgacctctgaacgctgcctcatcgaggggaccattgatggcctggagcctgggctgcacggactccacgtccatcagtttggggacctcacggggagctgcgacagctgtggggaccactttaaccctgatggagcatctcacgggggccctcaggactctgaccggcaccgtggagacctggggaacgtgcacgctgatgctgacggccgagccagcttcaggatagaggacgagcagctgaaggtatgggatgtgatcggccgaagcctggtcatcgacgagagagaagacgacctgggccggggtgaccatcccttatccaaggtcacggggaactcaggagagaggttggcctgtggcatcatcgcacgctctgctggcctcttccagaaccccaagcagatctgctcctgtgatggcctcaccatctgggaggagcgaggccggcctatcgctggtgagggacggaaggagccagccaagccgcctgcccacctctgagcacggcctcagcccaggggttggggctgttctccccgctgagaaccgtccacttccatagagaggggagggaggccctacttgcctggtcccagcagaactcaggtacggggtgtgaagggtcactttgatgttcccttggcaaattaaagttttattttcatatggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]