2025-09-14 19:22:42, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_022464324 5350 bp mRNA linear INV 14-SEP-2017 DEFINITION PREDICTED: Crassostrea virginica copper-transporting ATPase 1-like (LOC111122539), mRNA. ACCESSION XM_022464324 VERSION XM_022464324.1 DBLINK BioProject: PRJNA379157 KEYWORDS RefSeq; corrected model. SOURCE Crassostrea virginica (eastern oyster) ORGANISM Crassostrea virginica Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia; Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae; Crassostrea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_035782.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Crassostrea virginica Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## frameshifts :: corrected 1 indel ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-126 MWPT03000003.1 63401867-63401992 c 127-248 MWPT03000003.1 63399067-63399188 c 249-1338 MWPT03000003.1 63394373-63395462 c 1339-1560 MWPT03000003.1 63394045-63394266 c 1561-1724 MWPT03000003.1 63392169-63392332 c 1725-1784 MWPT03000003.1 63392013-63392072 c 1785-1785 "N" 1-1 1786-1886 MWPT03000003.1 63391912-63392012 c 1887-1966 MWPT03000003.1 63391699-63391778 c 1967-2204 MWPT03000003.1 63391354-63391591 c 2205-2438 MWPT03000003.1 63391006-63391239 c 2439-2579 MWPT03000003.1 63390358-63390498 c 2580-2688 MWPT03000003.1 63389952-63390060 c 2689-2813 MWPT03000003.1 63389707-63389831 c 2814-2948 MWPT03000003.1 63389478-63389612 c 2949-3140 MWPT03000003.1 63389167-63389358 c 3141-3323 MWPT03000003.1 63388888-63389070 c 3324-3531 MWPT03000003.1 63388344-63388551 c 3532-3693 MWPT03000003.1 63387908-63388069 c 3694-3836 MWPT03000003.1 63387126-63387268 c 3837-4040 MWPT03000003.1 63386786-63386989 c 4041-4158 MWPT03000003.1 63386414-63386531 c 4159-4261 MWPT03000003.1 63386204-63386306 c 4262-5350 MWPT03000003.1 63385000-63386088 c FEATURES Location/Qualifiers source 1..5350 /organism="Crassostrea virginica" /mol_type="mRNA" /isolate="RU13XGHG1-28" /isolation_source="Rutgers Haskin Shellfish Research Laboratory inbred lines (NJ)" /db_xref="taxon:6565" /chromosome="3" /tissue_type="whole sample" /geo_loc_name="USA" /collection_date="22-Mar-2015" gene 1..5350 /gene="LOC111122539" /note="The sequence of the model RefSeq transcript was modified relative to its source genomic sequence to represent the inferred CDS: inserted 1 base in 1 codon; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 3 Proteins, and 98% coverage of the annotated genomic feature by RNAseq alignments, including 14 samples with support for all annotated introns" /db_xref="GeneID:111122539" CDS 120..4511 /gene="LOC111122539" /note="The sequence of the model RefSeq protein was modified relative to its source genomic sequence to represent the inferred CDS: inserted 1 base in 1 codon" /codon_start=1 /product="LOW QUALITY PROTEIN: copper-transporting ATPase 1-like" /protein_id="XP_022320032.1" /db_xref="GeneID:111122539" /translation="
MLGEETQEMEKVTDLHIEGMTCQSCIDKIQDHMAREPGVIHVQMFLEEKEAKITYSPTETSPPILAEQISDMGFPSKVKLVHPVRGDNCQDAIINVGGMTCQSCVKSIESKMLEVSGILGITVSLLKKQAYVQFNPGKISAESIASAIDDMGFEASVHSITRDKGLTTKIGVEGMTCQSCVNSIESAMRGKPGVREIKVSLSDKEAHIVYDPTLTSPGSLRDQIDDMGFEATLARESSIESEFDRLASRQSSTRSVQSELVCQIAVKGMTCQSCVKNIESNISPKPGVMSISVSLEKEMASVTYNPLVTNPTSIAGMIDDMGFEASVEGSDAEPSTDTVVVGVEGMTCHSCVKSIEEHISKNPAVKSIKVSLADQNANIEYYPNRATPSTLRDAIDDMGFTASLPTDDVAVKVVQPKKSSGIKPKSPSESLKIELDKGAVSFRKGGDIVDDDLEKCFLRVTGMTCASCVATIEKNLMKVEGIHSCLVALMAQKAEVKYDPAYLLPSQIAAKISSLGFEATVLESEGFGQGVVELLITGMTCSSCVHMIESSIMKKXGVIQASVALSTCKGKFTYNPEVTGPRAIIEAIKSLGYQAELYTDDDKDAARYDHRDEIKRWRTSFLWSLIFGVPSVVIMMYFMFTPPPEEHNSVTNTTAGNYTTTHKPQTSSEGHYQIMIVAGLSLDNLLMFILATPVQFIGGRYFYIQAFKALRHGAANMDVLVVLATTISYVYSCVVVIVAMIMKEKTSPVTFFETTPMLMVFISLGRWLEHVAKGKTSEALAKLMSLQASEAVLVEIDKEFNILNEQTINVDLVQRGDVLKVVPGEKIPVDAKIIEGTTTCDESLITGESMPVSKKPGSSVIGGSINQHGMILVQATHVGSDTTLSQIVKLVEEAQTSKAPIQQLADKIAGYFVPGVVILSTLTVIAWAIVGYVDVTKVMPDFVNDGTISRDEVIFQKAFQYAITVLSIACPCALGLATPTAVMVGTGVGATNGILIKGGEPLECSHKLKCIVFDKTGTVTHGVPRVARVAMFVENSICSFVKLIAIAGTAENSSEHPLASAIVKYAKQTLKTETLGKTQNYQAVPGCGLKCTVTQIDGILVDIDMEGVNNRKNLMGSTRVKTDNVLYDGEEISATIEESSLVGAVASRPYDVLIGNREWMTRNGLIVTDKMDETMTEHEHQGQTAILCAIDGKIIAMLAVADTVKSEAHLAISVLKDMGLQVVLLTGDNQKTARAIARQIGIHKVFAEVLPSHKVKKIKQLQKQGMKVAMVGDGVNDSPALAQADVGIAIGTGTDVAVEAADVVLIKNDLLDVAAAIQLSKKTVRRIRINFFAASIYNLIGIPIAAGIFVPWGLSLKPWMASAAMAMSSVSVVFSSLLLKTFKKPNKEKMLTPKYYAKFAADQELDNISVHRGVESLPSSREGSKQGSIISRLSGRKKPTTPDHTSLLEMGENSDSDSSDQLG"
misc_feature 144..356 /gene="LOC111122539" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 393..590 /gene="LOC111122539" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 633..815 /gene="LOC111122539" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(642..650,657..659) /gene="LOC111122539" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 906..1097 /gene="LOC111122539" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(924..932,939..941) /gene="LOC111122539" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1146..1328 /gene="LOC111122539" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1155..1163,1170..1172) /gene="LOC111122539" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1491..1679 /gene="LOC111122539" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1506..1514,1521..1523) /gene="LOC111122539" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1716..1907 /gene="LOC111122539" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1734..1742,1749..1751) /gene="LOC111122539" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1980..4196 /gene="LOC111122539" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3027..3029,3033..3035,4128..4130) /gene="LOC111122539" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3159..3167,3369..3371,3579..3587,3675..3677, 3795..3803,3861..3863,3870..3872,3879..3881,3936..3938, 3945..3947) /gene="LOC111122539" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
tctgtatgtctcaagtctacacaccatttgaagtaatgtttttcaaatcaaagattttatattaggtaaatagtttttcattttattacaaacatacatgtaccttaaggaaggcaacaatgttgggagaagaaacacaggagatggaaaaggtaacagacctccatattgagggcatgacctgccagtcgtgtattgataaaatccaagaccacatggctcgggaaccaggggttattcatgtacagatgtttctggaggaaaaagaggcaaagattacttacagtcccactgagacatcccctcccatactggctgaacaaatctcagacatggggttcccttcaaaggtcaagctagtgcatccagtgaggggagacaactgtcaggatgccatcatcaatgtagggggcatgacatgtcagtcttgtgtcaagtccatagagtccaaaatgttggaggtcagtgggatactgggaataacagtgtccctgttgaagaaacaggcctatgtccagttcaacccgggcaaaatatctgctgagagtattgcttcagccatagatgacatgggttttgaggcctcagtacattccatcacacgtgataagggtctgaccaccaagataggggtggagggcatgacatgccagtcttgtgtcaactccatcgaatctgccatgagaggcaagccaggagtaagagaaataaaggtgtctcttagtgataaagaggcccacatagtgtatgatcccaccctcaccagtccgggatcactccgggatcagattgatgatatgggatttgaagcaacactggcaagagagtcctctattgagagtgaatttgaccgcttggcgtcacgacagtcatccaccagatcagtgcaaagtgaattagtctgccaaatagctgtgaaagggatgacctgtcaatcttgtgtgaagaatattgaaagcaacatttcacccaaacccggagtaatgtctatatctgtgtcattggaaaaagaaatggccagtgtgacttacaaccccctggttaccaatcccacctccatagctgggatgatcgatgacatgggatttgaggcctcggtagagggttcggacgcagagccgtccactgatacggtggttgtgggagtagaaggcatgacctgccattcctgtgtaaaaagcatcgaggaacacatctccaagaacccggctgtcaagtccatcaaggtctctctggcagatcagaatgccaacattgagtattatcccaatagggccactccatccactttgagagatgccatagatgacatgggctttactgcatctctaccaacagatgatgtagcagtgaaggttgtacagcccaaaaagagcagtgggatcaaaccaaagtctccttcagagagtttgaagattgagctagataaaggagctgtgtctttcaggaagggaggggacattgttgatgatgacctagagaagtgctttctgagagtcacagggatgacctgtgcttcctgtgtggccaccatagagaaaaatctaatgaaagtagagggtatacacagttgtttggtagccctgatggcacagaaagcagaggtgaaatatgacccagcctatttattgccatcccagattgcggctaaaatttccagcttggggtttgaagccaccgttttggagagtgaaggatttggccagggagttgtggaacttttgataacagggatgacatgttcttcatgtgtgcacatgattgaatcctccatcatgaagaagnccggggtgatccaggcctcagtggccctatccacctgtaaaggcaagttcacctataacccggaagtcacaggtccaagggcaatcattgaggccatcaagtctttgggataccaagctgagttgtacactgatgatgataaagatgctgctcgttatgaccatagagacgaaatcaaaaggtggagaacctcctttctgtggtctctgatctttggagttccatctgtggtgatcatgatgtacttcatgtttactcctccccctgaggagcacaattctgtcactaatactaccgcagggaattacaccaccacccacaaaccccagacgtcatctgaaggtcactaccagatcatgatagtagccggtctctcactggacaaccttcttatgtttattttggccacaccggtacagtttattggtggacgatacttctacatacaagctttcaaggcgctccgacacggagcagcaaacatggacgtcctggttgttcttgccaccactatctcctacgtgtactcctgtgtggtggtcatcgtggccatgatcatgaaggagaaaactagccccgtgactttctttgaaacaactcccatgttgatggtgtttatatcccttggtagatggctggaacatgtagcaaagggtaaaacatcagaagctcttgccaagctgatgtctctgcaggcttcagaggctgtgctggtggagattgataaagaattcaatattctgaatgaacaaacaattaatgtggatttagtgcagagaggggatgtacttaaggttgttcctggtgaaaagattcctgtggatgccaagatcattgagggaaccaccacttgtgatgagtcccttattacaggggagtctatgcctgtctctaagaagccaggttcctctgtgattggtggttccatcaatcagcatggcatgattctagtgcaggctacacatgtggggtctgacaccaccctgtcccagattgtcaagctcgtggaagaggctcagacctcaaaggcgcctatacagcagcttgctgacaagatagctgggtatttcgtacctggggtggtcattctgtccactcttactgtcattgcttgggccatagtgggctatgttgatgtcaccaaagtcatgccagacttcgtgaatgatgggaccatttccagagatgaggtcatcttccagaaggctttccagtatgccatcacagttctaagtattgcctgtccttgtgccctggggctggccacacccacagctgtcatggtgggaactggtgtaggggccacaaatgggatactgatcaaggggggtgaacccctggaatgttctcacaaattgaagtgtatagtgtttgataagactgggacggttacccatggggttcctcgtgtcgcccgtgtggccatgtttgtggagaactcaatctgctcatttgtcaaactaatagccattgctggaactgctgaaaatagcagtgaacatcccctggcttcagccatcgtcaagtatgcaaaacagactctgaagacggagaccttgggtaagacccagaactaccaggcagtgccaggctgcggtctcaagtgtaccgtgacccagatcgacgggatactggtggacattgacatggagggagtgaacaacaggaagaacctgatgggcagcaccagagtcaagaccgacaatgtcctgtacgacggggaggagattagcgctacaattgaggagagtagtttggttggtgcagtggcctccaggccctacgacgtactgattggaaaccgtgaatggatgacaaggaatggattgattgtgacagataaaatggacgaaacaatgactgagcacgaacatcagggacaaacagccattctgtgtgctattgatggtaaaattatagcgatgttggctgtggccgacactgtgaagtccgaggctcacctagccatcagtgtccttaaagacatggggctacaggtggttctactgaccggagacaaccagaaaactgccagagccattgctagacagattggaatccacaaagtctttgctgaagttctaccctctcacaaagtaaagaagataaaacagcttcagaagcagggtatgaaggtggcaatggtaggggatggggtgaatgactcgcctgccctggcccaggcagatgtgggcatcgccataggaaccgggaccgatgtagctgtggaggcggctgatgtggtcctcatcaagaatgatcttctagatgtggcagcagccattcagctctccaagaaaactgtccggagaatacgcatcaactttttcgctgcttccatttacaacttgattggcatcccaatcgcagctgggatctttgtgccgtggggactgtccctcaagccctggatggcgtcagcagctatggccatgtcctcagtatctgtggtcttttcctccttactcctcaaaacgtttaagaagcccaacaaggaaaagatgctgactcctaaatattatgcaaagtttgctgcggaccaggagctggacaatatttctgttcatcgaggcgtggagagtttgccatccagccgtgaaggaagtaagcaaggaagcatcatttcacgcttgagtggtcggaagaagccaaccacgccagatcacacaagtctgctggagatgggagagaactctgactccgactccagtgatcagctgggataggcatcaactggctgctttagtttgtgaatcatgaacttgtataaacttgtttcaggtagataccactgtcatcataatattgtaaccagacactaaatcacagtcgccaagattaggaaaaagtcggtcatatttatagctcagtggtccaatacatttagtttcaaatcaggcatttgagccccaagtttttaaaaatatgatacaacattatgctaaattatgttcagtacattggtacatgtattacaaaaaatcaagtcacagaactgtgatacattaacatttgattcagagctcatttctccttccccttttaaaaatgtttcacgcgttagatatttggtttttatattgatttgaagctttcacaagaattagttttgcatcatggtagaatatttatctagttttcacaactctagtatatatatcacttatgacaaacttaatataatcatgtaatcattgtcatgttttttgcttttaaggattttgcttggtaacacttacaggagtatttttactactcagttgtgtacttaagagtcccaaccatttaccagtttttgaccactgatgatgtgtcccatttgttgtccatcctttacatacacacctaccactgcagtccctcaaatacatctgtaatacagtccgtcagaatgaaaagttcaaacaacacaattgatttgttgttcagaatagaacaggccaataatctggataaagcagagctttgacagacagtttcatctgtctcctactgaatttgttatgacttgtaactgttgcttatacatgtgtgttatgaataaatatcatatattatagaggag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]