GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 11:29:25, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_021916304             543 bp    mRNA    linear   PLN 20-JUL-2017
DEFINITION  PREDICTED: Chenopodium quinoa G-type lectin S-receptor-like
            serine/threonine-protein kinase RLK1 (LOC110736155), mRNA.
ACCESSION   XM_021916304
VERSION     XM_021916304.1
DBLINK      BioProject: PRJNA394242
KEYWORDS    RefSeq.
SOURCE      Chenopodium quinoa (quinoa)
  ORGANISM  Chenopodium quinoa
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; Caryophyllales; Chenopodiaceae; Chenopodioideae;
            Atripliceae; Chenopodium.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018743292.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Chenopodium quinoa Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..543
                     /organism="Chenopodium quinoa"
                     /mol_type="mRNA"
                     /cultivar="QQ74"
                     /db_xref="taxon:63459"
                     /chromosome="Unknown"
                     /tissue_type="leaves"
                     /dev_stage="flowering"
                     /geo_loc_name="Saudi Arabia"
     gene            1..543
                     /gene="LOC110736155"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:110736155"
     CDS             1..531
                     /gene="LOC110736155"
                     /codon_start=1
                     /product="G-type lectin S-receptor-like
                     serine/threonine-protein kinase RLK1"
                     /protein_id="XP_021771996.1"
                     /db_xref="GeneID:110736155"
                     /translation="
MAAWPLPSTLSLLTLILLQSSPIAAQNKGNIPVGQSLSAATNNSSWHSPSGDFAFGFSKFSNSSNLFLLAIWYVKIPTTIVWYANDGNPVPQGSSVKITANEGLVLSDPNGIDLWNTSDTLSDGGEVKYGYLNDTGNFALKSSSSDNPVWQSFNHPTDTLLPSQVMEINMEVNSKL"
     misc_feature    121..468
                     /gene="LOC110736155"
                     /note="Bulb-type mannose-specific lectin. The domain
                     contains a three-fold internal repeat (beta-prism
                     architecture). The consensus sequence motif QXDXNXVXY is
                     involved in alpha-D-mannose recognition. Lectins are
                     carbohydrate-binding proteins which specifically...;
                     Region: B_lectin; cd00028"
                     /db_xref="CDD:237995"
     misc_feature    order(121..123,130..132,214..216,241..246,343..345,
                     349..351,373..375,379..381,391..393,397..423,427..468)
                     /gene="LOC110736155"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:237995"
     misc_feature    order(187..189,196..198,202..204,211..213,217..219,
                     295..297,301..303,307..309,313..315,319..321,397..399,
                     403..405,409..411,415..417,421..423)
                     /gene="LOC110736155"
                     /note="mannose binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:237995"
ORIGIN      
atggcggcttggcctcttcctagcaccctctccttgttaacactaatactcctacaatcatcacctattgctgcccaaaataaaggcaatataccagtaggacaatccctatcagctgccaccaataattcttcatggcattccccttcgggcgatttcgcctttggcttttccaaattttcaaacagcagcaatctcttcttgcttgccatctggtatgtcaagattcccaccaccattgtttggtacgcaaatgatggtaatcctgttcctcaaggatcatcagtcaagattacagctaatgagggactagttctcagtgatcctaacggaattgacctatggaacacctctgatacgctaagtgatggaggtgaggtaaagtatggctacctgaatgatactgggaatttcgccctcaaaagtagcagcagtgacaatccagtttggcagagctttaaccatcctacagacaccttgctgccttctcaggttatggagataaatatggaggttaactctaagctataaagaactaatttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]