GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-03 09:34:32, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_020306928            2611 bp    mRNA    linear   PLN 02-DEC-2021
DEFINITION  PREDICTED: Aegilops tauschii subsp. strangulata
            ubiquitin-like-specific protease 1D (LOC109747855), transcript
            variant X1, mRNA.
ACCESSION   XM_020306928
VERSION     XM_020306928.3
DBLINK      BioProject: PRJNA702515
KEYWORDS    RefSeq.
SOURCE      Aegilops tauschii subsp. strangulata
  ORGANISM  Aegilops tauschii subsp. strangulata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Pooideae; Triticodae; Triticeae; Triticinae; Aegilops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_053041.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 2, 2021 this sequence version replaced XM_020306928.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Aegilops tauschii Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2611
                     /organism="Aegilops tauschii subsp. strangulata"
                     /mol_type="mRNA"
                     /cultivar="AL8/78"
                     /sub_species="strangulata"
                     /db_xref="taxon:200361"
                     /chromosome="7D"
                     /tissue_type="seedling"
                     /geo_loc_name="USA: California"
     gene            1..2611
                     /gene="LOC109747855"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 20 long SRA reads, 3 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 73 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:109747855"
     CDS             2..2317
                     /gene="LOC109747855"
                     /codon_start=1
                     /product="ubiquitin-like-specific protease 1D isoform X1"
                     /protein_id="XP_020162517.1"
                     /db_xref="GeneID:109747855"
                     /translation="
MPEAPAVSIVDFSSAASSFSSPTPTSPRPRPLGEPRRAAVNAMATASSEPLPSGEEGDEDAGARIDDDLRGMSDQALKERFKRLQDGLNKFPGVLPDGGKKYRRSLRAVRGELDRRTRLASDSASLRPRPRPPRPQGRLGEPDGNRGERMIQSSCAEPSGLSSKCNENHGVTKSDFLSAFEVDDEAGIDVEITSICPGKTKTPVENKGKSYEVSESCKTNAQPTPPKVLCIDNSIDVENMSSDDDFKDNGDIRTRENASTPSRKRKGDDSVNFSMRLRPRKAQEVVLLDADAHHSESAEKPTTKRDAMKIYYPSSEHSNSIELSHDDIKCLEPESLLSSTIMNFYIMYLQGPMSSISTQRGKYHIFNTYFFKKLEALKSKVDKPSYFLNLRRWWKGIDIFQKPYILFPVHADTHWSLVIICMPAKEDQSGPIILHLDSLKFHNSRLIFSVVERFLKQEWNYLKENGSLAECPIRETVWKKLPHKIEKKPIAVPQQENEFDCGLFVLYYMQRFIEEAPERLHKKDLSMFGKTWFQPEEASALRKKMKTLLHQLFEEADPSNDSTSEQTACQLLLEAKPANNVMELATSEHPLEVSSAEVIPTSEHLLEVGSVEMTPMSEHPLEVGSAEMSPTQEHPLVGSSGEMAPAQEHPLVGSSAEMEPTQEHPLVGNSAEMEPKQEYPLVGSSAEMAPTQEHTLVGSSAEMAPTQEHPLVGSSAEMEPTQEHPTVGSSAEMEQTQGHPMVGSSAEITSQKPLEGTSTRPTSFEHPLECS"
     misc_feature    1010..1600
                     /gene="LOC109747855"
                     /note="Ulp1 protease family, C-terminal catalytic domain;
                     Region: Peptidase_C48; pfam02902"
                     /db_xref="CDD:397169"
     misc_feature    <1661..2221
                     /gene="LOC109747855"
                     /note="EBNA-3B; Provisional; Region: PHA03378"
                     /db_xref="CDD:223065"
     polyA_site      2611
                     /gene="LOC109747855"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
tatgccagaggccccggctgtcagcatcgtcgacttctcctccgccgcctcctctttctcttccccaaccccaacttcccctcgaccccgccccctcggcgagccgcgccgcgccgcggtgaatgcgatggccacggcttcgtcggagccgctccccagcggcgaggagggggacgaggatgcgggggcgaggatcgatgacgaccttcgcggcatgtcggaccaggcgctgaaggagaggttcaaacgcctacaggacgggctcaacaaattccccggcgtcctcccggacggtgggaagaagtaccgccgctcgctccgggccgtccgcggcgagctcgaccgccgcactcgcttggcctcggactcggcctctctccggccacggccgcggccgccgcgtccgcaaggccgcctaggcgagccggatggcaatagaggtgaacggatgatccagtcaagttgtgcagaaccgtctgggttgtctagtaaatgcaatgaaaatcatggagtaaccaaatctgatttcctttctgcatttgaggtggatgatgaggcaggcatcgatgtggagataacaagtatatgccctggcaagactaaaacgccagtagaaaataaagggaagtcgtatgaagtaagtgaatcttgcaaaaccaatgcacaaccaacgcctcccaaagtattatgtatcgacaactcaatcgacgtggaaaatatgtcttctgacgatgacttcaaggataacggcgatattaggacacgtgaaaatgcttccacaccttctcggaaaaggaaaggagatgactcagtaaacttctcaatgcgattgagaccaagaaaggctcaagaggtggttctactcgatgcagatgcacaccattcagaatctgcagagaagccaaccactaaacgggatgcaatgaagatatattatccctcaagcgaacactcaaattctattgagctttctcatgatgacataaaatgccttgagcctgaatcgttactttcctcaactataatgaacttctacattatgtacctgcaagggccaatgtcatcgattagtacacaaagaggcaagtatcacattttcaatacatacttcttcaagaaacttgaagccctaaaatcaaaggtagacaagccttcttatttcttaaacctgagaagatggtggaaaggcatagatatatttcaaaagccatatatattatttcctgtgcatgcagatactcattggagcctggtgattatatgcatgccagcaaaggaagatcaatcaggccccattatacttcatttggattcactgaagttccataacagcagattgattttcagtgttgttgagagattcttaaaacaagaatggaattacctgaaggaaaatgggtctttagcagaatgtcctatacgagaaacggtgtggaagaaacttcctcataaaattgagaagaaaccaattgcggttccgcagcaggaaaatgaatttgactgtggcctctttgttctgtactatatgcagcggttcatcgaggaggcacctgaaaggcttcacaagaaagacctttctatgtttggcaaaacatggtttcaacctgaagaggcttctgcattgcgaaagaaaatgaagaccctgcttcatcagttgtttgaggaagcggatcccagtaacgatagtacatcggagcagacagcgtgtcagttgcttttggaagctaagcctgcaaacaacgtgatggagctggcaacgtcagaacaccctttggaagtcagttcagctgaggtgataccaacgtcggaacacctgctggaagtcggttctgttgagatgacaccaatgtctgaacaccctttggaggtcggttctgctgagatgtcaccaacgcaagaacatcctttggtgggcagttctggtgagatggcaccagcgcaagaacatcctttggtgggcagttcggctgagatggaaccaacacaagaacatcctttggtgggcaattcggctgagatggaaccaaagcaagaatatcctttggttggcagttcggctgagatggcaccaacgcaagaacataccttggtgggcagttcggctgagatggcaccaacgcaagaacatcccttggtgggcagttcggccgagatggaaccaacgcaagaacatcctacggtgggcagttccgccgagatggaacaaacgcaaggacatcctatggtgggcagttccgccgagattacatcgcagaaacctttggaaggcacttcgacccgaccaactagttttgagcaccctttggaatgcagctgattgatgttaccacctttggagcgacctacgttacccgtagaaaccgaaaccggctcggaattgtattatagatgggaaggtgttgtagcctgcatctgtgggcaactttgagggaggggtggtgttgcatgactgaacgttgcagttaatgtatccgcgggaactaccgtgtatatataatatcagtaggagaaatggtgggtgtacgagtcgctcaggatggacttcatctgtttagttatttataggctaggctggaagaggtcaataaaatctcaggctctgattagacga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]